ID: 1137396133

View in Genome Browser
Species Human (GRCh38)
Location 16:48117258-48117280
Sequence CACCTCAGTCAGGTCTCCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137396133 Original CRISPR CACCTCAGTCAGGTCTCCAT AGG Exonic
900595848 1:3479803-3479825 CACCTGGGGCAGGTCTGCATAGG - Exonic
900959337 1:5909286-5909308 CCACGCAGTCAGGTCTCCACAGG + Intronic
902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG + Intronic
902660025 1:17894609-17894631 GACCTCAGACAAGTCTCCCTCGG + Intergenic
903446964 1:23428669-23428691 CAGACCAGTCAGGTCTCCAGGGG + Exonic
903762160 1:25706406-25706428 CCCCTAAGGCAGGTCTCCAGTGG - Intronic
905422704 1:37859420-37859442 GACCTCAGTTTGGTCACCATAGG - Intronic
909781347 1:79551211-79551233 AACCACAGTCAGGTCTGCCTTGG - Intergenic
913711456 1:121488086-121488108 CACTTCAGCCATGTCTTCATAGG - Intergenic
914462570 1:147898523-147898545 CACCTCAGTGAGGTCTCTTTGGG + Intergenic
920338102 1:205258369-205258391 GACCTGAGTCAGTTCACCATGGG - Intronic
920684228 1:208096809-208096831 CACCTCTGTCAGGTTCCCAAAGG + Exonic
924622923 1:245678033-245678055 CATCTCAGGCTGGTCTCCAAGGG + Intronic
1064242883 10:13646769-13646791 CTCCTCAGTCAGGTTTTCAAGGG + Exonic
1070850247 10:79557380-79557402 ACCCTCAGTCAGGCCTACATAGG + Exonic
1070856978 10:79613920-79613942 ACCCTCAGTCAGGCCTACATAGG - Exonic
1070891553 10:79945240-79945262 CAACTCAGTCTGGCCTCCAGTGG - Intronic
1072251975 10:93588954-93588976 CTCCTCAGAAAGGTCTCCTTAGG - Exonic
1072690463 10:97569527-97569549 CCCCACAGTCAGATCTCCCTAGG - Intronic
1074534015 10:114315779-114315801 CAGCTCGGTCAGGGCCCCATGGG + Intronic
1076483697 10:130801987-130802009 CACCCCCGTGAGGTCTCCAGAGG + Intergenic
1078621832 11:12915342-12915364 CCCCACAGCCAGGTCTCCAGAGG + Intronic
1078752595 11:14179120-14179142 CAACTCAGTCAGCTCTGTATTGG + Intronic
1085311870 11:75521727-75521749 GACCTCAGTCAGGTCTTGACAGG + Intronic
1088999698 11:115041537-115041559 CATCTCACTCCGGTCTCCAGAGG - Intergenic
1091596554 12:1882624-1882646 CACCTCAGGCAGGTCTGCTGGGG + Intronic
1092663495 12:10766447-10766469 CTCCTCAGTCAGATTTCCACTGG - Intergenic
1093147275 12:15581722-15581744 CTCCACAGTGATGTCTCCATAGG - Exonic
1094179067 12:27571635-27571657 CACCCCAGTGAGGTCATCATAGG - Intronic
1095112678 12:38315755-38315777 AACCTCAGTCAGGTTGCCTTTGG - Intergenic
1095569166 12:43663038-43663060 CATCTCAGTCAGGACTCTCTTGG - Intergenic
1096273807 12:50188685-50188707 CACCTCACTTAGGTCTCCTTTGG - Intronic
1096628955 12:52913153-52913175 CACCTGACTCTGCTCTCCATGGG - Intronic
1099768493 12:87021350-87021372 CAACTCAGTGGGTTCTCCATTGG + Intergenic
1106450385 13:29876452-29876474 CACGTCAAACAGGTCTTCATTGG - Intergenic
1107404304 13:40098438-40098460 CCCCACAGACTGGTCTCCATGGG + Intergenic
1108496788 13:51033510-51033532 CACCTCAGTCAGTCACCCATGGG + Intergenic
1111665820 13:91266917-91266939 CACCACACCCATGTCTCCATTGG + Intergenic
1112286914 13:98112466-98112488 CACCTCATTCAGGTCTCTGCTGG + Intergenic
1115143383 14:30199298-30199320 CACCTCTGGCAGGCCCCCATAGG + Intergenic
1118533333 14:66731409-66731431 CACCTCAGCCTGGACTTCATTGG - Intronic
1122738401 14:103856803-103856825 CACATCAGTCAGGGTCCCATAGG + Intergenic
1126040625 15:44586984-44587006 GAGCTCAGTTAGGTCTCCCTGGG - Intronic
1130410353 15:83642763-83642785 CACCTCATGCAGCTCCCCATGGG - Intergenic
1131797888 15:96038610-96038632 AACATCACTCAGGTCTCCAGTGG - Intergenic
1133679764 16:8109934-8109956 CACCTCAGAAAGGACTCTATGGG + Intergenic
1134018629 16:10906670-10906692 CACCTCAGCCAGGCCTCCTTGGG - Exonic
1137396133 16:48117258-48117280 CACCTCAGTCAGGTCTCCATAGG + Exonic
1137407729 16:48203225-48203247 CACCTCTGTCATGTCTCCAAAGG + Exonic
1137512003 16:49108916-49108938 CCCCACAGCCAGGTCTGCATGGG + Intergenic
1138455400 16:57117841-57117863 CACATCAGGCAGGGCCCCATTGG - Intronic
1138634569 16:58327400-58327422 CACCTCAGGCAGCTCTCAAAGGG - Intronic
1140318697 16:73926516-73926538 CACTTCATTCTGGGCTCCATAGG + Intergenic
1140383368 16:74511043-74511065 CTCCTCGGTCAGTCCTCCATTGG - Intronic
1146513292 17:33469232-33469254 CACCCCAGTCTGTGCTCCATGGG - Intronic
1147365301 17:39955011-39955033 CACCTCACTCAGCTCTGCAGAGG - Intergenic
1148220539 17:45858696-45858718 CACCTGAGTCAGGGACCCATGGG - Intergenic
1155582465 18:27324818-27324840 CCTCCCAGTCAGGTCTCTATTGG + Intergenic
1157317076 18:46601260-46601282 CCCCTGAGTCGGGTCTCCGTCGG - Intronic
1162380990 19:10331881-10331903 CTCCCCAGTCAGGTACCCATGGG - Intronic
1164710102 19:30350029-30350051 TACCTCAGATAGGTATCCATTGG - Intronic
1166764243 19:45243492-45243514 GACCTCCTTCCGGTCTCCATGGG + Intronic
1168190652 19:54736150-54736172 CACCACAGTCAGGCCTTGATGGG + Exonic
1168200794 19:54814016-54814038 CACCACAGTCAGGCCTTGATGGG + Exonic
1168208045 19:54866700-54866722 CACCACAGTCAGGTCTTGAGGGG + Exonic
925147022 2:1588457-1588479 CCCCCCACTCAGGTCTCCACCGG + Intergenic
927478554 2:23432837-23432859 CAGGTCACTCAGGTTTCCATTGG + Intronic
927954113 2:27196200-27196222 CACCTCAGCCAGGGCTACATGGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
930975202 2:57450350-57450372 CACCTCAGTCAAGTTTCTGTAGG + Intergenic
932442730 2:71748107-71748129 CACAGCAGCCAGGACTCCATGGG - Intergenic
942307711 2:174625041-174625063 CCCCTCACTCAGGTCTCCTTGGG + Intronic
943315889 2:186386740-186386762 CACCTCAGCCTGGACTTCATTGG + Intergenic
944589367 2:201202732-201202754 CACCTTGGTCAGGTCCCCTTGGG + Intronic
945523417 2:210858559-210858581 CATCTTACTCAAGTCTCCATGGG - Intergenic
947573475 2:231253613-231253635 CACTTCAGCCAGGTCCCCAGCGG - Intronic
1171231796 20:23492761-23492783 AAGATCAGTCAGGACTCCATAGG - Intronic
1175320946 20:58087938-58087960 GATCTCAGTCAGATCTCCCTGGG + Intergenic
1181996113 22:26884059-26884081 CTCCTCAGCCAGGTCCCCAAAGG - Intergenic
951022233 3:17793497-17793519 GACCTCAGGCTGGTGTCCATTGG + Intronic
955400957 3:58591272-58591294 CAGTTCAGACAGGTCTCAATGGG + Intronic
955783113 3:62507217-62507239 CACCCCAGTCAGTTCTTCTTAGG + Intronic
956010770 3:64829259-64829281 CACATGAGTGAGGTCACCATGGG + Intergenic
956164484 3:66386061-66386083 CACCTCCGTCAGGTCACTTTCGG - Exonic
958435748 3:94093545-94093567 CACCTCTATCAGGTCTCTAGGGG - Intronic
959135433 3:102413078-102413100 CACCTCAGTCATCTGTCCTTTGG + Intronic
961494866 3:127284243-127284265 CACCTCAGGCTGGGCTGCATGGG + Intergenic
961650256 3:128413563-128413585 CACCTCATTCAGGGCTCCAGGGG - Intergenic
963208069 3:142656887-142656909 GATCTCAGTCAATTCTCCATAGG + Intronic
968800906 4:2742797-2742819 CTTCTCAGTCAGGTCTCCTGGGG - Intronic
968891980 4:3374324-3374346 CACCACTGTCAGGTCTTCACGGG + Intronic
969150346 4:5163976-5163998 GTCCACAGTCGGGTCTCCATGGG - Intronic
970838755 4:20442133-20442155 CACCGCAATCTGTTCTCCATTGG - Intronic
977742932 4:100508313-100508335 CACACCAGTCAGGGCTCAATGGG + Intronic
985162798 4:187061865-187061887 CACTTCCTTCAGTTCTCCATGGG + Intergenic
985591847 5:769928-769950 GACCTCGGTCAGGGCTCCTTGGG - Intergenic
985609761 5:880880-880902 GACCTCGGTCAGGGCTCCTTGGG - Intronic
992397421 5:76380691-76380713 CTCCTCACTCAGGAATCCATGGG + Intergenic
996747411 5:126857284-126857306 CAGCTCAGCCTGGTCTCCCTGGG + Intergenic
997296835 5:132773846-132773868 CACCTTAGGAAGGTCTCCTTGGG - Intronic
998225129 5:140321134-140321156 CACCTCAGCCAGGACACCACAGG + Intergenic
1000128677 5:158273487-158273509 CACCACATTCAAGTCCCCATTGG - Intergenic
1005783592 6:29219159-29219181 CAACTCAGTTAGGTCACCTTAGG - Intergenic
1009949026 6:70374288-70374310 CACCTGTGTTAGGTCTTCATAGG - Intergenic
1012298161 6:97550176-97550198 CACTTCACACAGGTCTCCATGGG - Intergenic
1016905607 6:149147821-149147843 ATCCTCAGTGAGGTCTGCATTGG - Intergenic
1019735675 7:2648783-2648805 CTCCTCGCTCAGGTCTCCTTGGG - Intronic
1020098328 7:5380680-5380702 CCCCTCAGTCAGGACTGCAAGGG + Intronic
1023208342 7:37775702-37775724 CACCTCAGCCTGGGCTTCATTGG - Intronic
1025853846 7:65262168-65262190 CACCCCTCTCAGGTCACCATTGG - Intergenic
1033619965 7:143053064-143053086 CACCTCACACTGGTCTTCATCGG + Exonic
1035242824 7:157543353-157543375 CACCTCAGCCACTTCTCCACCGG - Intronic
1037681022 8:21097569-21097591 CACCTAACTCAGCTCTCCATTGG - Intergenic
1038607116 8:29018377-29018399 TAACTAAATCAGGTCTCCATAGG - Intronic
1039888275 8:41667863-41667885 CACGTCACCCAGGTCACCATAGG + Intronic
1040085608 8:43337280-43337302 CACCTCAGCCTGGACTTCATTGG - Intergenic
1041588034 8:59544632-59544654 CAGCTCAGCCAGGTCTTCTTGGG - Intergenic
1044716277 8:95102645-95102667 CACCTCCCTCAGGTACCCATGGG - Intronic
1046604984 8:116361415-116361437 CCCCTCAGTCCCATCTCCATGGG + Intergenic
1049238210 8:141523369-141523391 CAACTCAATCAATTCTCCATCGG - Intergenic
1049784182 8:144442775-144442797 CATCTCATTCAGCTCTCCCTGGG + Exonic
1049860290 8:144893672-144893694 CACCTCTGCCAGGTTTCCAGGGG - Intronic
1050145336 9:2560972-2560994 CACCGCAGCCATGTCTGCATTGG - Intergenic
1051803314 9:20961791-20961813 TTCCTCACTCAGGTCTCCACTGG + Intronic
1054301641 9:63384986-63385008 CACCCCGGTCAGGGCTCCAGGGG - Intergenic
1055800270 9:80027644-80027666 CCCCTCAGCAAGGTCTCCATAGG + Intergenic
1060216882 9:121743782-121743804 CAGCTCATTCAGGTCTCCCTGGG - Intronic
1061801437 9:133115291-133115313 GCCCTCAGCCAGGTCTCCTTGGG - Intronic
1186089769 X:6033661-6033683 CACCTCAATAAGATCTGCATAGG + Intronic
1194483949 X:94463405-94463427 CACATCAGTCATGTCTACACAGG - Intergenic
1194624656 X:96213959-96213981 CACCTCAGCCTGGACTTCATTGG + Intergenic
1195644821 X:107218126-107218148 CACCTAATGCAGGTCTCCACCGG + Intronic
1202180798 Y:22138254-22138276 CACCTCAGACTGGCCTCCAACGG + Intergenic
1202210562 Y:22448146-22448168 CACCTCAGACTGGCCTCCAACGG - Intergenic