ID: 1137396363

View in Genome Browser
Species Human (GRCh38)
Location 16:48118276-48118298
Sequence CAGAGAAAACCGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137396363_1137396374 28 Left 1137396363 16:48118276-48118298 CCCTCCTCCCTCGGTTTTCTCTG 0: 1
1: 0
2: 1
3: 41
4: 529
Right 1137396374 16:48118327-48118349 CCATAAGCAGAACCTTCCCCAGG 0: 1
1: 0
2: 2
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137396363 Original CRISPR CAGAGAAAACCGAGGGAGGA GGG (reversed) Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
901040190 1:6358874-6358896 CAGAGAAAGGCGAGGGAGCAGGG + Intronic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
903076952 1:20777843-20777865 CAGAGAATTCCAAAGGAGGATGG - Intronic
903108005 1:21101580-21101602 AAAAAAAAACCGAGGGAGGGAGG + Intronic
903178863 1:21595500-21595522 CTGAGAAGGCCTAGGGAGGAGGG - Intergenic
903906420 1:26690711-26690733 CAGACAAAATGGAGGGAGGCAGG - Intergenic
904984862 1:34537027-34537049 TAGAAAAAGCCGAGGGAAGAGGG - Intergenic
905657618 1:39695218-39695240 CAGAGAAAACCCAGGGAATCAGG - Intronic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
907913986 1:58852324-58852346 CACAGAAAAGGGAGGGAGGGAGG + Intergenic
908116998 1:60950287-60950309 CATAGAAAACCAATGCAGGAAGG - Intronic
908135283 1:61125918-61125940 CAGAGAAAAGTGAGGAAGGTAGG + Intronic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
909313138 1:74179263-74179285 CAGAAAAAAACGAGGAAGCATGG - Intronic
909483966 1:76153813-76153835 CAGAGAAAAACGAGAAGGGAAGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910011352 1:82467165-82467187 GAGAGAAAAAGGAGGGAGCAGGG - Intergenic
911047346 1:93639421-93639443 CTGAAAAAACCAAGGGAAGATGG + Intronic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912555550 1:110513641-110513663 CAGAGAAAAAGGAGAGAGGCGGG - Intergenic
915036486 1:152931139-152931161 CAGAAAAAACGGAGGAAGCATGG - Intergenic
915046409 1:153021077-153021099 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916383383 1:164238858-164238880 CAGAGTATAGCTAGGGAGGAAGG - Intergenic
916992428 1:170258480-170258502 AAGAGAAAACCAAGAGAGCAGGG - Intergenic
917231689 1:172844750-172844772 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917621114 1:176796904-176796926 AAAAGAAAATAGAGGGAGGAAGG - Intronic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
918182126 1:182093504-182093526 CAGAGAAAAACGATGCAGGCCGG + Intergenic
918665623 1:187146876-187146898 AAGAAAAAAGGGAGGGAGGAAGG - Intergenic
919944374 1:202308888-202308910 CATTGAATGCCGAGGGAGGAGGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920136023 1:203770025-203770047 CAGAGATCACCTAGGTAGGAAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922275424 1:224073188-224073210 CAGAGAAAACCAAGGGGAGGGGG + Intergenic
923250952 1:232179260-232179282 AAGAGAAAAGGGAGGGAGGGAGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923455786 1:234164171-234164193 AAGAGAAAAGCAAGGGAGGCAGG - Intronic
923503881 1:234589273-234589295 CACAGAAAGCCAAGGGAGGGAGG - Intergenic
924202643 1:241675306-241675328 AAGAGAAAAGGAAGGGAGGAGGG - Intronic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
924589040 1:245385991-245386013 CAGAGAAAGCCGAAAGAGTAAGG + Intronic
1062931731 10:1357340-1357362 CTGAGAAAAATGAGGGAGGTTGG + Intronic
1062991711 10:1825506-1825528 CAGAGAGATGCGAGGAAGGAAGG - Intergenic
1063398541 10:5717502-5717524 CAGTGAAAAACGAGGAAGAAAGG - Intronic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064341413 10:14489006-14489028 CAGAGGGAAGCTAGGGAGGAGGG + Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1066286459 10:33971205-33971227 GAGAGAAAACCAAAGGAGCATGG - Intergenic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1067765391 10:49082012-49082034 CAGAGAACAGCCAGGGAGGGGGG - Intronic
1068263692 10:54619490-54619512 AAAAGAAAACTGAGGGAGAAAGG - Intronic
1069041532 10:63700562-63700584 CAGAGAAAAGGGAGGCAGTAAGG + Intergenic
1069152336 10:64979330-64979352 AGGAGAAAACGGAGGGAAGAAGG - Intergenic
1069362704 10:67661276-67661298 AAGAGAAAAAGGAGGGAGGGAGG + Intronic
1069821109 10:71229336-71229358 CAGAGGAGACCCTGGGAGGATGG + Intronic
1070339726 10:75486711-75486733 GAGAGAAAGCCCAAGGAGGAGGG - Intronic
1070935952 10:80295386-80295408 CAGACCAAACCTAGGGAAGAAGG + Intergenic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1071886029 10:89951654-89951676 CAGAGACAACAGAGAGAGAATGG - Intergenic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072797194 10:98365113-98365135 AAGAGAAAAAGGAGGGAGAAGGG + Intergenic
1073059260 10:100723797-100723819 GAGAGAAAACTGAGGGGGAAGGG + Intergenic
1074649184 10:115500055-115500077 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1075130371 10:119732883-119732905 CACAGTAAACCTTGGGAGGATGG + Intronic
1075514937 10:123101093-123101115 CAAAGCAACCCAAGGGAGGAAGG - Intergenic
1075806391 10:125192157-125192179 CAGAGAAAGCCCAGGTAGGCAGG - Intergenic
1076106247 10:127825945-127825967 CCGAGAAGAGCCAGGGAGGAAGG + Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1077321849 11:1946380-1946402 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1078272426 11:9808599-9808621 CTGACAAAACCCAGGAAGGATGG + Intronic
1078518787 11:12047226-12047248 CAGAGAGAAACCAGAGAGGATGG - Intergenic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1086546613 11:87975104-87975126 CAGAGAACACCATGGGAAGATGG - Intergenic
1086954188 11:92918851-92918873 CAGTGAAAACCAAGGAGGGAGGG + Intergenic
1087047414 11:93853683-93853705 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1087479590 11:98681585-98681607 GAGAGAAAACCGAGAGTGAAAGG - Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1090210183 11:124915277-124915299 AAGAGAAAATCGAGAGATGAGGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1202804866 11_KI270721v1_random:1693-1715 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1092941379 12:13410373-13410395 CAGAGACAAAGGAGGGAGGTGGG + Intergenic
1093796790 12:23322166-23322188 AAGAGAAAAGGGAGGGAGGGAGG - Intergenic
1094075371 12:26466754-26466776 CAGAGAAAACACAGGGTGCAGGG + Intronic
1095385527 12:41645723-41645745 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
1096476231 12:51910881-51910903 CAGAGGAAGCCCAGGCAGGAAGG + Intronic
1096765871 12:53888933-53888955 GAAAGAAGACGGAGGGAGGAAGG - Intergenic
1097285857 12:57876715-57876737 CAGAGACAAACGAGGGAGACAGG - Intergenic
1097370144 12:58768493-58768515 CTAAGAAAACTGAGTGAGGAAGG + Intronic
1097376383 12:58848227-58848249 CAAAAAAAAGGGAGGGAGGAAGG - Intergenic
1098785973 12:74756290-74756312 CAGAGAAAAGGGTGGGAGGAGGG - Intergenic
1098842470 12:75493091-75493113 CAGATGAAACGGGGGGAGGAAGG + Exonic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099227514 12:79987235-79987257 CAGGAAAAAACGAGGGAGTAAGG - Intergenic
1099415951 12:82386498-82386520 GAGAGAAAAGGGAGGAAGGAAGG - Intronic
1099530995 12:83781201-83781223 CAGCTAAAACCCAGAGAGGATGG - Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100356791 12:93838534-93838556 AAGAGAGAAGCAAGGGAGGAAGG - Intronic
1100744751 12:97633547-97633569 TGGAGAAGACCAAGGGAGGATGG - Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101677160 12:106927515-106927537 CAGAAAAAACCTAGTGAGGCTGG - Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102433717 12:112903715-112903737 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1102974218 12:117194849-117194871 CAAAGAAAAGAGAGAGAGGAAGG - Intergenic
1103038199 12:117673318-117673340 CAGATAAAAGGAAGGGAGGATGG + Intronic
1103058911 12:117843200-117843222 AAGGGAACACCGAGGGATGAAGG + Intronic
1103405582 12:120672731-120672753 CAAAGAAACCCAAGGGAGGCTGG + Intergenic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1104766977 12:131336417-131336439 CAGAGAGGACCGAGGAAGGTTGG - Intergenic
1107878837 13:44815564-44815586 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1110241696 13:73274653-73274675 GAGAGAAAAGGAAGGGAGGAAGG + Intergenic
1110306615 13:73995306-73995328 TAGACAAAAATGAGGGAGGAAGG + Intronic
1111814396 13:93132448-93132470 CAGAGAAAAGCAAGGAAGGATGG - Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114889217 14:26895809-26895831 AAGAGATGACCGAGGTAGGAAGG + Intergenic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116966268 14:51018302-51018324 AAGAAAAAAGGGAGGGAGGAGGG - Intronic
1117320433 14:54617481-54617503 CAGAGAAAAGTGGGGGAGCAAGG + Intronic
1118478777 14:66143367-66143389 CAAAGAAAACAGAGAGGGGATGG + Intergenic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118917753 14:70122140-70122162 CAGAGAAAACTGGGGGACGAGGG + Intronic
1118938871 14:70314290-70314312 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1118991929 14:70804903-70804925 CAGAAAGAAGGGAGGGAGGAAGG + Intronic
1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG + Intronic
1120402837 14:84054414-84054436 CAGAGAAAAGCAAGGCAAGAAGG + Intergenic
1121077009 14:91077296-91077318 AAGAAGAAAGCGAGGGAGGAAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1122186451 14:100001033-100001055 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1122433467 14:101674399-101674421 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1122468510 14:101950294-101950316 CAGAGATAACCCAGAGATGAGGG + Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126707203 15:51416641-51416663 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130867874 15:87947701-87947723 AAGAGAAAACAGGGAGAGGAAGG + Intronic
1131081751 15:89542461-89542483 CAGAGAAAAACGAAAGAAGAAGG - Intergenic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1131780151 15:95847202-95847224 AAAAGAAAAACAAGGGAGGAAGG - Intergenic
1132030046 15:98431762-98431784 AAGAGAAAAGGGAGGAAGGAAGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133702529 16:8322445-8322467 CAGAGAAAACCGAGGGTGTGAGG - Intergenic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135480884 16:22819187-22819209 AAGAGAAAAGGAAGGGAGGAAGG - Intronic
1135492968 16:22925743-22925765 AAGAGAAGAGCCAGGGAGGATGG + Intergenic
1136574397 16:31114912-31114934 AAAAGAAAAAAGAGGGAGGAAGG - Intergenic
1136698206 16:32105613-32105635 AAGAGGAAAGGGAGGGAGGAAGG + Intergenic
1137357984 16:47785080-47785102 AAGAGAAAAGGGAGGAAGGAGGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137701350 16:50500293-50500315 CAGTGACAACCCAGGGAGGGAGG + Intergenic
1137820392 16:51439129-51439151 AAAAGAAAAAAGAGGGAGGAAGG + Intergenic
1138059487 16:53875031-53875053 AAGAGGGAAGCGAGGGAGGAAGG + Intronic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138378367 16:56582667-56582689 CAAGGAAAAACGAGGGAGGGAGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140912186 16:79464311-79464333 CTGAGAGGACCGAGGGAGTAGGG + Intergenic
1141825564 16:86477203-86477225 CAAAGAAAAGCAAGGGAGGGGGG + Intergenic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143763817 17:9124372-9124394 GAGAGAAGCCGGAGGGAGGAGGG - Intronic
1145226589 17:21133786-21133808 AAGAGAAAATGGGGGGAGGAAGG + Intronic
1146942182 17:36850926-36850948 CAGAGAAGACCCAGAAAGGAAGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147428197 17:40356256-40356278 CAGAGAAAAGCCGGGGCGGAGGG - Exonic
1147515666 17:41115408-41115430 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1147851226 17:43444681-43444703 GAGAGAAAACCTGGGGAGAACGG + Intergenic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1149018513 17:51936384-51936406 GAGAGAAAACCTAGGTAGCATGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1155040995 18:22065669-22065691 GAAAGAAAAGGGAGGGAGGAAGG - Intergenic
1156909072 18:42389361-42389383 CAGAGGTGACCCAGGGAGGATGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158251067 18:55488172-55488194 CAATGAAAACCCAGGGAGTAAGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158762249 18:60403630-60403652 CAGAGTAAAACAAGAGAGGAGGG - Intergenic
1158943107 18:62424585-62424607 CAGAGAACACCGTGTGACGACGG + Intergenic
1160616336 18:80132583-80132605 AAGAGAAAAGAGAGGAAGGAAGG - Intronic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162951518 19:14074239-14074261 CCCAGGAACCCGAGGGAGGAGGG - Intronic
1163504253 19:17695488-17695510 CAAAGAAAAAGGAGGGAGGGAGG + Intergenic
1163755738 19:19105343-19105365 CCCAGAAAACATAGGGAGGAAGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164044921 19:21529015-21529037 CAAAGAAAACCTAAGGAAGAAGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164937051 19:32223225-32223247 GAGAGAAAAGAGGGGGAGGAAGG + Intergenic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1166623130 19:44322946-44322968 CAGAGACAAAGGAGGGAGGTGGG - Intergenic
1167083507 19:47293420-47293442 CAGAGAAAACCGAGAGGAGAGGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167194276 19:48016431-48016453 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1167390966 19:49194696-49194718 GAAAGAAAAGAGAGGGAGGAAGG - Intronic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928164804 2:28962840-28962862 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
928252891 2:29697344-29697366 GAGAGAAAAGAGAGGCAGGAAGG + Intronic
928373775 2:30759158-30759180 AGGAGAAAAACGAGGGAGGGAGG - Intronic
928465927 2:31522318-31522340 CAGAGAAAGTGGAGGAAGGAGGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929535611 2:42782368-42782390 AAGAGAAAATAGGGGGAGGAAGG - Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
931913150 2:66924249-66924271 CAGAATAAAACAAGGGAGGAGGG - Intergenic
934108436 2:88717843-88717865 AAGAGAAAATAGGGGGAGGAAGG + Intronic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935096415 2:99948513-99948535 CAGAGAAACTCAAAGGAGGAAGG + Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935655755 2:105421182-105421204 CAGAGAGAACCCAGTGACGATGG - Intronic
936478433 2:112862888-112862910 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937397038 2:121546472-121546494 CGGAGAAAAGCAAGGCAGGACGG + Intronic
938145723 2:128833514-128833536 CAGAGGAAGGCGTGGGAGGAGGG + Intergenic
938675088 2:133624508-133624530 CGAAGAACACCAAGGGAGGAAGG - Intergenic
938794344 2:134705591-134705613 CAGAGGAAGCCGGGGTAGGAAGG - Intronic
940987904 2:160066644-160066666 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
942455587 2:176136284-176136306 CAGAGAAAGAGAAGGGAGGAAGG + Intergenic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
944175888 2:196829161-196829183 AAGAGAAAAACTAGTGAGGAAGG + Intergenic
944340434 2:198589987-198590009 TAGAGGAAACCGAGCGAGGCTGG + Intergenic
944536316 2:200713803-200713825 CAGAGAGGACCAAAGGAGGAAGG - Intergenic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944683168 2:202095449-202095471 CACAAACAACCCAGGGAGGAAGG - Intronic
944711460 2:202338502-202338524 CAAAGAAAAAGGAGGGAGGGAGG - Intergenic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946226299 2:218265759-218265781 CAGTGAAGACCCAGGAAGGAAGG + Intronic
947530868 2:230907938-230907960 CAGAGAAAGAAGTGGGAGGAGGG + Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
948086362 2:235252819-235252841 GAGAGAAAAGGGAGAGAGGAAGG + Intergenic
948107426 2:235426822-235426844 GAGAGAAAAGGGAGGGAGGGAGG + Intergenic
948256489 2:236572504-236572526 CATATACAACTGAGGGAGGATGG - Intronic
948356751 2:237384412-237384434 CAGAGAGAGGCGTGGGAGGAGGG - Intronic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1169850914 20:10049714-10049736 ATGAGAAAACCCGGGGAGGAGGG + Exonic
1169968537 20:11243707-11243729 GGGAGAAAACCTAGGAAGGATGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1172171741 20:32939626-32939648 GAGAGAGAAAGGAGGGAGGAAGG - Intronic
1174306027 20:49614931-49614953 TAGAGAAAACAAAGGGAGAACGG + Intergenic
1174335193 20:49854700-49854722 AGGAGAAAACCGAGGGACAACGG - Intronic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175231563 20:57476773-57476795 CAGAGACAATCTAGGGAGGCAGG - Intergenic
1177748452 21:25250770-25250792 CAGAGAAAACCTCAGGATGAAGG - Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178185835 21:30219131-30219153 CAGAAAAGCCCGAGGGAGGGTGG - Intergenic
1178365905 21:31988629-31988651 GAGAGAAAAATGAGGGAGGGAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178710411 21:34911748-34911770 CAGAGCAAGCCGAGGGAGACAGG - Intronic
1179296857 21:40070373-40070395 GAGAGAAAAGCAAGGAAGGAAGG + Intronic
1179651634 21:42813333-42813355 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1183118784 22:35713503-35713525 CAGATAAAATCCACGGAGGATGG - Intergenic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1184085724 22:42262623-42262645 CAGAGATCACCGAGGGAGAAAGG + Intronic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184596797 22:45518832-45518854 TAGAGAAAAGTGGGGGAGGAAGG + Intronic
1184917855 22:47585214-47585236 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
949360033 3:3221894-3221916 CAGAGAAAGCCAGGGAAGGAAGG - Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950251848 3:11472238-11472260 CAGGGAAAACCCAGGCAAGAGGG - Intronic
950431124 3:12951812-12951834 CAGTGGAAACCTAGGGAGGGTGG + Intronic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950599937 3:14024945-14024967 AAGAGAAAATAGGGGGAGGAAGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951298041 3:20963433-20963455 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
952422524 3:33144841-33144863 CAGAGAAAACCAAGAGAGTGTGG + Exonic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954391847 3:50271706-50271728 CAGAGAGAGACAAGGGAGGAAGG + Intronic
954651401 3:52166159-52166181 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
956558222 3:70544267-70544289 CAGAGAAATCCTAGGCAGGCAGG - Intergenic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957668093 3:83262670-83262692 AAGATAAAACTGAGGGAGCAGGG - Intergenic
958164059 3:89856452-89856474 CAAAATAATCCGAGGGAGGAAGG + Intergenic
959090934 3:101901980-101902002 CAGAGAAAACAGGGGCGGGAAGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960228150 3:115191911-115191933 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
960556639 3:119037309-119037331 CACAGCAAACCCAGGGGGGATGG + Intronic
961004635 3:123396712-123396734 GAGAGAGAAGGGAGGGAGGAAGG + Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961340114 3:126212250-126212272 GAGAGAAGAAGGAGGGAGGAAGG + Intergenic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
962210039 3:133470036-133470058 GAGAGAAAACCCAGGGAGGTTGG + Intronic
962245466 3:133787355-133787377 CAGAGAGAAGGGAGTGAGGAAGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
962918780 3:139933327-139933349 TAGAGAAAATGAAGGGAGGAGGG + Intergenic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
964435254 3:156644310-156644332 CAGAGCAGAGCAAGGGAGGAGGG - Intergenic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966534077 3:181011519-181011541 CAGAGAAAAGGGTGGGAGCAGGG - Intergenic
966594575 3:181713585-181713607 CAGAGAAAACCTGGGGAGGGTGG + Exonic
967147037 3:186615142-186615164 AAAAGAAAACGGAGGAAGGAAGG + Intronic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967883103 3:194315423-194315445 CAGAGAACAGCCAGGGAAGATGG + Intergenic
968043687 3:195611382-195611404 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968832574 4:2940719-2940741 CAGACAAAACGCAGGGAGCACGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
969715376 4:8865796-8865818 CAGATGAAACCGAGTGAGAACGG + Intronic
970302514 4:14696407-14696429 CAGAGAAGACCAAAGGAGAAAGG + Intergenic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972357316 4:38292174-38292196 CAGAGAAAACTTTGGGAGCAAGG - Intergenic
972801787 4:42483456-42483478 AAAACAGAACCGAGGGAGGAAGG + Intronic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
973547471 4:51996038-51996060 CAGAGAGGCCCCAGGGAGGAAGG - Exonic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
977259078 4:94776400-94776422 AAGAAAAAAGCCAGGGAGGAAGG - Intronic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979024023 4:115544691-115544713 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
980196804 4:129599917-129599939 CAGAGAAAACCAAGAAAGGGAGG - Intergenic
980233639 4:130075753-130075775 CAGAGAAAACCTAGGCAGACAGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980505878 4:133720592-133720614 AAGAGAGAAGGGAGGGAGGAAGG + Intergenic
980972476 4:139579951-139579973 CAGAGCAAACCAAGAGAGCAAGG - Intronic
981253617 4:142634025-142634047 CAGATAAAAAGGAGGGAGGTGGG + Intronic
981459054 4:144990912-144990934 CAGAGACAAACTAGGGAGGTAGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982475873 4:155849945-155849967 AAGAGAAAATAGTGGGAGGAAGG - Intronic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
984375281 4:178922071-178922093 CAGAGAAAGCCAAGGCAGCAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985067076 4:186133074-186133096 CAGTGAATGCCTAGGGAGGAGGG - Intronic
985548313 5:520871-520893 CAGAGGAAGCCCAGGAAGGAAGG + Intronic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987385929 5:17329380-17329402 AAGAAAAAAGGGAGGGAGGAGGG - Intergenic
987849051 5:23325242-23325264 CAGAGAAAAAAGAGACAGGAGGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988699966 5:33663431-33663453 AAGAAAAAAAGGAGGGAGGAAGG + Intronic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989316960 5:40092565-40092587 AAGAGAAAATAGTGGGAGGAAGG - Intergenic
989353657 5:40516856-40516878 CAGAGAAACCCCAGTGTGGAAGG - Intergenic
991040025 5:62165539-62165561 CCATTAAAACCGAGGGAGGAAGG + Intergenic
991423555 5:66466409-66466431 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
991647755 5:68818442-68818464 CAGAGAAGACTGCGGGAGGGAGG + Intergenic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
993283560 5:85959947-85959969 GAGAGAAAAAGGAGGGAGGGTGG - Intergenic
993524210 5:88944521-88944543 CAGAGAACTTCCAGGGAGGAAGG + Intergenic
993687821 5:90961563-90961585 CGTAGTAAACTGAGGGAGGAGGG + Intronic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
996403944 5:123089063-123089085 GAGAGAGAACGGAGGGGGGAGGG - Intergenic
997710702 5:136001635-136001657 CAGAGAAAAGCCACAGAGGAAGG - Intergenic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
999781490 5:154854267-154854289 GAGAGAAAACCCAGGAAGGCTGG - Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1000973358 5:167738783-167738805 CAGAGAAACACCAGGGATGAGGG - Intronic
1001298377 5:170515338-170515360 AAGGGAAAAACCAGGGAGGAGGG - Intronic
1002038462 5:176492181-176492203 AAGAGCAAACCTGGGGAGGAAGG - Exonic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002184702 5:177448744-177448766 CGGAGAAAATGGAGGGAGGGAGG - Intronic
1002382033 5:178837989-178838011 AAGAGAAAACCGTGAGGGGAAGG + Intergenic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1002648742 5:180675697-180675719 AAGAGAAAACCGTGAGGGGAGGG - Intergenic
1002703751 5:181146779-181146801 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003775330 6:9354306-9354328 CAGAGACAAAGGAGGGAGGCAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005322640 6:24669722-24669744 AAGAGAAAATAGGGGGAGGAAGG + Intronic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006851909 6:37104507-37104529 GAAAGAAAGCCGAGGGAGGTTGG - Intergenic
1007407547 6:41643663-41643685 GAGAGAGAAAGGAGGGAGGAAGG + Intronic
1007975712 6:46099131-46099153 CACACAAAACTGAGGGAAGAAGG + Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1011303274 6:85899024-85899046 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1011695741 6:89911207-89911229 GAGAGAAAAAGGAGGGAGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012231200 6:96762698-96762720 CAGAGAAGACTGAGGCAGCAGGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1015422741 6:133029907-133029929 CAGAGAATTCCCAGGCAGGAAGG - Intergenic
1015683517 6:135834206-135834228 TAAAGAAAACCTAAGGAGGACGG - Intergenic
1016633128 6:146255525-146255547 AAGAGAAATCTCAGGGAGGAAGG - Intronic
1017067966 6:150547717-150547739 AAGAGGAAAGGGAGGGAGGAGGG + Intergenic
1017541713 6:155409338-155409360 CAGAGGAAACCGATGGGGGTGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019062080 6:169263727-169263749 CAGAGAAGACCCTTGGAGGAGGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289803 7:244943-244965 CTGAGAACAGCGTGGGAGGACGG + Intronic
1019341059 7:509160-509182 CAGCGCAACCCCAGGGAGGAAGG + Intronic
1019406570 7:887162-887184 CAGAGCACAGCGAGGAAGGAAGG - Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1020008983 7:4798403-4798425 CAGAGAAACCCTGGGGAAGAGGG - Intronic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1022038856 7:26560174-26560196 TACAGAAAACAGAGGTAGGATGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022458734 7:30584090-30584112 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1023259458 7:38344328-38344350 GAGAGAAAAACAAGGAAGGAAGG + Intergenic
1023259916 7:38348652-38348674 GAGAGAAAAGCAAGGAAGGAAGG + Intergenic
1023260899 7:38357811-38357833 GAGAGAAAAGCAAGGAAGGAAGG + Intergenic
1023261875 7:38366928-38366950 GAGAGAAAAGCAAGGAAGGAAGG + Intergenic
1024572125 7:50732087-50732109 CACAGAAGACCGAGGCAGAAAGG + Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024935440 7:54707228-54707250 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026874771 7:73872894-73872916 GAGAGAGAAAGGAGGGAGGAAGG - Intergenic
1026892909 7:73992755-73992777 CAGAGAGAAGCGAGGGCCGAGGG + Intergenic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028764077 7:94530850-94530872 GGAAGAAAACCAAGGGAGGAAGG + Intronic
1029267236 7:99352048-99352070 AAGAGAAAGCCAAGGGAGGCTGG - Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029732184 7:102445818-102445840 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1030440511 7:109583556-109583578 GAGAAAACACCGAGGGTGGATGG + Intergenic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1031143469 7:117971948-117971970 AAGAGAGAAGGGAGGGAGGAAGG - Intergenic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1032565318 7:132935926-132935948 CACACAAAACAGAGAGAGGATGG + Intronic
1033240454 7:139674901-139674923 CAGAGAAGAGCCAGGGTGGATGG - Intronic
1034093040 7:148381748-148381770 CAGAGAAAATCTAGGCAGAAAGG - Intronic
1034960535 7:155361757-155361779 CAGAGACAGCCCACGGAGGAAGG + Intronic
1035475571 7:159141825-159141847 CAGAGAAAGCTGAGGGACAAAGG + Intronic
1036675954 8:10833445-10833467 AGGAGAAAAAGGAGGGAGGAAGG + Intronic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037805387 8:22055716-22055738 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1038327080 8:26579373-26579395 CAGTGAAATCCCAGGGAGGGGGG + Intronic
1038806206 8:30794493-30794515 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
1039977611 8:42380693-42380715 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1040978209 8:53217536-53217558 CAGCGGAAACCCAGTGAGGAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1043590231 8:81822847-81822869 AAGAGAAAAATAAGGGAGGATGG + Intronic
1044034796 8:87287384-87287406 CACAGATAACAGAGAGAGGATGG + Intronic
1044143061 8:88678259-88678281 GAGAGCAAAACCAGGGAGGAAGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045755257 8:105534146-105534168 AAGAGAGAAAGGAGGGAGGAAGG - Intronic
1046222544 8:111235072-111235094 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1048363151 8:133715311-133715333 AAGAGAAAAGGGAGGAAGGAAGG - Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1050366966 9:4881721-4881743 AAGAAAAAAGGGAGGGAGGAAGG - Intronic
1050413411 9:5389561-5389583 CAGAGAAAACCTGGAGAGGTGGG + Intronic
1050990418 9:12144369-12144391 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051837908 9:21361781-21361803 CAGAGTACAGCGAGGGATGAGGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052283791 9:26761936-26761958 CAAAGAAAACTTAGGAAGGAGGG + Intergenic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053786212 9:41654605-41654627 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054158839 9:61659593-61659615 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054174927 9:61868550-61868572 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054478613 9:65590598-65590620 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054662612 9:67712243-67712265 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054986748 9:71270570-71270592 AAGTGAATACCTAGGGAGGAGGG - Intronic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057467131 9:95324331-95324353 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1058187676 9:101874580-101874602 CAGAGAAGACCCAGGGAAGAAGG - Intergenic
1058658020 9:107242382-107242404 AAAAGAAAAGGGAGGGAGGAAGG + Intergenic
1058670663 9:107358182-107358204 CACAGAAAACACAGGAAGGAAGG - Intergenic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1060014312 9:120073348-120073370 AAGAGAAAGCTGAGGCAGGAAGG + Intergenic
1061281982 9:129602751-129602773 GAGAGAGAAGGGAGGGAGGAAGG + Intergenic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061676044 9:132216222-132216244 CAGAAAGAAGCAAGGGAGGAAGG - Intronic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062095410 9:134700693-134700715 CAGAGAAGACCGGGTGTGGACGG - Intronic
1062575862 9:137207386-137207408 CAGAGAACACGGTGGGAGTAGGG + Intronic
1185574584 X:1160935-1160957 GAGAGAGAACCGAGGGAAAAGGG + Intergenic
1185610929 X:1393106-1393128 CGGAGAAAAAGGAGGGAGGCGGG - Intergenic
1185780497 X:2840220-2840242 CAGAGAAACCCTGGTGAGGACGG + Intronic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1188255321 X:27955706-27955728 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1189124832 X:38435475-38435497 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1193958883 X:87899159-87899181 CAGAGAAAGCAGAGGAAGAAGGG + Intergenic
1194492633 X:94570138-94570160 CAGAGAAAACTGGGGAAGAAGGG + Intergenic
1195150659 X:102066448-102066470 AAGAGAAAATAGGGGGAGGAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196542341 X:116924400-116924422 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1196834450 X:119801723-119801745 GAGAGAAGAGGGAGGGAGGAAGG - Intergenic
1196939433 X:120760979-120761001 CAGAGAAAAGGAAGGAAGGAAGG - Intergenic
1196980935 X:121213034-121213056 CAGAGATAAAGGTGGGAGGAAGG - Intergenic
1197402044 X:126005065-126005087 CGGAGAAAAGCAAGGCAGGAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198020831 X:132656364-132656386 CAGAGAATACTCAGGGAGCAAGG - Intronic
1198434231 X:136599622-136599644 GACAGAAAAAAGAGGGAGGAAGG + Intergenic
1198536872 X:137595039-137595061 AAGAGAAAACCAAGAGAGGTGGG + Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199539955 X:148947720-148947742 GAGACAAAAACGAAGGAGGAAGG + Intronic
1199887197 X:152031886-152031908 AAGAGAAAATAGGGGGAGGAAGG + Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic
1201454968 Y:14159806-14159828 CAAAGAGAACCAAGGAAGGATGG - Intergenic