ID: 1137400975

View in Genome Browser
Species Human (GRCh38)
Location 16:48154224-48154246
Sequence CTGGACAGGCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 748}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137400967_1137400975 21 Left 1137400967 16:48154180-48154202 CCCTCTGCTAGCAGGCAGGGGGT 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG 0: 1
1: 0
2: 4
3: 64
4: 748
1137400971_1137400975 -8 Left 1137400971 16:48154209-48154231 CCTAACCTCAACAGACTGGACAG 0: 1
1: 0
2: 2
3: 8
4: 121
Right 1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG 0: 1
1: 0
2: 4
3: 64
4: 748
1137400969_1137400975 -3 Left 1137400969 16:48154204-48154226 CCTAACCTAACCTCAACAGACTG 0: 1
1: 0
2: 1
3: 14
4: 127
Right 1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG 0: 1
1: 0
2: 4
3: 64
4: 748
1137400968_1137400975 20 Left 1137400968 16:48154181-48154203 CCTCTGCTAGCAGGCAGGGGGTT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG 0: 1
1: 0
2: 4
3: 64
4: 748
1137400965_1137400975 22 Left 1137400965 16:48154179-48154201 CCCCTCTGCTAGCAGGCAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 209
Right 1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG 0: 1
1: 0
2: 4
3: 64
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137400975 Original CRISPR CTGGACAGGCAGAAGCAGGA AGG Intronic
900383134 1:2395322-2395344 CTGGTCTGGCAGGAGCAGGAGGG - Intronic
900611216 1:3545367-3545389 CTGCACAGGCAGCCGCAGGGGGG + Intronic
900651364 1:3731580-3731602 CTGCAGAGGCAGTAGCTGGAGGG + Intronic
900759558 1:4461847-4461869 GTGGCCAGGCAGAAGCAGGGAGG - Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
901433079 1:9229868-9229890 CTGGAGAGGCTAAGGCAGGAGGG + Intergenic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
901675085 1:10878625-10878647 GGGGACAGTCAGAGGCAGGAGGG + Intergenic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902513324 1:16977577-16977599 CTGGACAGAAATCAGCAGGAGGG - Intronic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902923893 1:19683138-19683160 CAGGGCTGGCAGCAGCAGGAAGG + Exonic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903232021 1:21927700-21927722 CTGGACTGGGAGAAGGAGGGGGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903304596 1:22403931-22403953 CTGGACCGGGAGCACCAGGAAGG - Intergenic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903626881 1:24737052-24737074 CTAGTGAGGCTGAAGCAGGAGGG - Intergenic
903661249 1:24980199-24980221 TTAGGGAGGCAGAAGCAGGAGGG - Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904716152 1:32469086-32469108 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905388987 1:37624294-37624316 CATAACAGGCAGCAGCAGGAGGG - Intronic
905417774 1:37816105-37816127 CTGGGCAGGCAGAACCAAGCAGG - Intronic
905528369 1:38656495-38656517 CTGGTCAGGGAGCAGGAGGAGGG + Intergenic
905799140 1:40832278-40832300 CAGCACAGGCAGAAACAGCATGG - Intronic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
907569259 1:55467936-55467958 CTGGACAGGCAGATTCAGGTCGG + Intergenic
907649957 1:56285628-56285650 GTGGCCAGGCACAAACAGGATGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908413952 1:63894203-63894225 CTGGGCAGGATGGAGCAGGATGG + Intronic
910260365 1:85288284-85288306 CTTGGGAGGCTGAAGCAGGAAGG + Intergenic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
912236494 1:107856929-107856951 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
912247350 1:107973874-107973896 CTGGACAGGCAGAACACAGAAGG + Intergenic
912252953 1:108030071-108030093 GTGGGCAGGCAGAATCAGTAAGG + Intergenic
912708090 1:111929685-111929707 GTAGAAAGGCACAAGCAGGATGG - Intronic
912778492 1:112522573-112522595 CTGCACAGGCAGCAGGAGGTTGG + Exonic
913105382 1:115609544-115609566 CTTGAGAGGCTGAGGCAGGAAGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914434303 1:147646711-147646733 CTCAGCAGGAAGAAGCAGGAAGG - Exonic
914447221 1:147760286-147760308 GTGGACAGGCAGGAACAGGCTGG - Intronic
914870335 1:151468345-151468367 CTGGAGAGGCTGAGGCGGGAAGG + Intergenic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
915588353 1:156857344-156857366 CTGGAGAGGCAGGGGCATGATGG - Intronic
915625026 1:157109169-157109191 CTGGTCAGGGAGAGCCAGGAAGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915916073 1:159941756-159941778 CTGGGCAGGCGGAGGCAGGGAGG + Intronic
915944318 1:160138731-160138753 CTGGAGAGGCTGAGGCAAGAGGG + Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917579646 1:176362582-176362604 CTGGACACCCAGCAGCAGTAAGG - Intergenic
918014698 1:180622054-180622076 CTCAACAGGCAGGATCAGGAAGG - Intergenic
919472426 1:197996022-197996044 CTGGACAGGATGGAGCATGAGGG + Intergenic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
920117831 1:203633264-203633286 ATGGACAGGGAGGAGCAGGGAGG + Intronic
920270235 1:204757254-204757276 TTGCCCAGGCAGATGCAGGATGG + Intergenic
920379467 1:205527369-205527391 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920713107 1:208314057-208314079 CTAGACTGGCAGAAGGAGGGTGG + Intergenic
922106333 1:222516603-222516625 GAGGACAGGCAGGGGCAGGAGGG + Intergenic
922223220 1:223624604-223624626 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922941351 1:229469752-229469774 CTGACCTGGCAGAAGCCGGAGGG + Intronic
923152925 1:231250321-231250343 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
923450249 1:234110391-234110413 CTGGAATGGCAGAGCCAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1062902622 10:1157391-1157413 ATGGACAGGGAGAGGCAGGTAGG + Intergenic
1063059147 10:2532798-2532820 CTGGAAGGGAAGAAGCTGGAAGG + Intergenic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063371066 10:5523511-5523533 TTGGGCAGGAGGAAGCAGGAAGG - Intergenic
1063422182 10:5921756-5921778 CTGGAAAGGCAGACACAAGAAGG + Intronic
1064279753 10:13940956-13940978 CTATAAAGGAAGAAGCAGGATGG + Intronic
1064707022 10:18083569-18083591 ATGGACAGGGAGAGGCAGGCAGG + Intergenic
1064967477 10:21029818-21029840 CTGGATAGGCAGTGGCAGAAGGG + Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065217535 10:23463789-23463811 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1065628433 10:27654059-27654081 CTTGAGAGGCAGAGGCAGGGGGG + Intergenic
1065847892 10:29761288-29761310 CTGGACAGGAGGAAGTAGGCAGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065870551 10:29952688-29952710 ATGGCAAGGCAGGAGCAGGAGGG + Intergenic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1067217604 10:44316029-44316051 GTGGCCATGCTGAAGCAGGAAGG + Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1069865278 10:71498505-71498527 CTGGACTGTCAGCTGCAGGAGGG + Intronic
1070382332 10:75892251-75892273 ATAGACAGGCAGAAGCTGAAGGG - Intronic
1070418074 10:76208738-76208760 CTGGATAGGCACAAGCAGAGGGG - Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1070917900 10:80166767-80166789 ATGGACAGTAAGGAGCAGGAGGG - Intronic
1071494878 10:86161376-86161398 CAGGACAGGCAGCTGCGGGAAGG + Intronic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073393392 10:103197921-103197943 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1074657976 10:115616847-115616869 ATGGCCAGGCAGAAGCTGGCTGG + Intronic
1074799963 10:116990000-116990022 CAGAACAGGCAGAAGCTGGTAGG + Intronic
1075078910 10:119369828-119369850 CTGGACAGGCAGTCGCTGGAAGG - Intronic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076520698 10:131079098-131079120 CTGGACAGGCCGAGCTAGGAGGG + Intergenic
1076565894 10:131398852-131398874 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1076695453 10:132245188-132245210 CTGTACAGCCAGGAGCAGGAGGG + Intronic
1076729203 10:132429813-132429835 CTGGGCAGGCAGGGGCAGGGTGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076934000 10:133555439-133555461 CTGGACAGGAAGAGGTAGGATGG + Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077034038 11:486335-486357 CTGGACAGACGGGAGCGGGATGG - Intronic
1077178077 11:1199584-1199606 GTGGACAGCCCCAAGCAGGAGGG - Intronic
1077189948 11:1251792-1251814 CAGGACAGGCAGACCCAGGTTGG - Intronic
1077250989 11:1560593-1560615 CTGGACAGGGGAAAGCAGGTAGG + Intronic
1077879456 11:6337322-6337344 TTTGGGAGGCAGAAGCAGGAAGG - Intergenic
1078060395 11:8039354-8039376 GGAGACAGGCAGAAGCTGGAAGG - Intronic
1078313062 11:10265795-10265817 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1078601365 11:12734025-12734047 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1078916593 11:15784142-15784164 CTGGACTGTAAGAACCAGGAGGG - Intergenic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079010783 11:16826438-16826460 TTCGAGAGGCAGGAGCAGGAGGG - Exonic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1080027098 11:27626444-27626466 CTGGATATGCAGAAGCGTGAGGG - Intergenic
1081504430 11:43700514-43700536 ATGGACAGACAGTAGAAGGATGG - Intronic
1081762317 11:45584967-45584989 GAGGACAGGCAGAAGAAGGTAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083634773 11:64114569-64114591 ATGGACAGGTAGATGCATGATGG + Intronic
1083710537 11:64545691-64545713 CTGGAGAGGCAGAAGCCTGGGGG - Intergenic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1084153911 11:67303536-67303558 CTGGACCCGCAGGACCAGGAAGG - Exonic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084529305 11:69717588-69717610 GTGTACAGGGAGAGGCAGGAAGG - Intergenic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1088471434 11:110191460-110191482 CTGAACAGGCAAAAGCTGGAAGG + Intronic
1088538862 11:110891903-110891925 CTGGACCTGCTGAAGAAGGAAGG - Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089666318 11:120022374-120022396 CTGCCCAGGCAGTAGCAAGATGG + Intergenic
1089960186 11:122610277-122610299 CAAGACATGCAGAAACAGGAGGG + Intergenic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1091129196 11:133129798-133129820 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1091143720 11:133258820-133258842 CTGGGCAGGCAGGGGCAGGCTGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1092611493 12:10178001-10178023 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1094003287 12:25719221-25719243 GTGGACAGGCATAAGTGGGAAGG - Intergenic
1094129477 12:27060113-27060135 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1094324439 12:29221371-29221393 CTGGTCAGGCAAGAGCAGGGTGG - Intronic
1094641639 12:32281746-32281768 CTGGGCAGCCAAAAGAAGGAGGG - Intronic
1095214684 12:39534193-39534215 CTGGACTGGCAGGGGCATGATGG - Intergenic
1095250748 12:39976638-39976660 CTTGGGAGGCTGAAGCAGGAAGG - Intronic
1095449463 12:42314707-42314729 CTGGGCAGGCTGAGGCAGGTGGG + Intronic
1095460333 12:42436786-42436808 TTGGGCAGGATGAAGCAGGATGG + Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096115958 12:49055302-49055324 ATGGACAGCCAGAAGCTGGCTGG - Exonic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1096845394 12:54403737-54403759 CTGGACTGGCAGAAGCAGAAGGG - Exonic
1096849766 12:54428102-54428124 CTGGACAGGCTGGAGGAGGTTGG + Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098229217 12:68355894-68355916 CTTGAGAGGCTCAAGCAGGAGGG - Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1099587857 12:84544634-84544656 CTGGAGAGGCTGAGGCAGAATGG - Intergenic
1100186644 12:92146161-92146183 CTGGACCTGCTGAAGCGGGAAGG - Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101621606 12:106394278-106394300 CAGGGCAGGCAGCACCAGGAAGG + Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1103092544 12:118107591-118107613 CTTGAAAGGCTGAGGCAGGAGGG + Intronic
1103743322 12:123105970-123105992 CAGGACAGGCAGGGCCAGGAAGG - Intronic
1103955871 12:124576519-124576541 TCGGACAGGCAGAAGCCAGAGGG - Intergenic
1103981932 12:124742354-124742376 GTGAACAGGCAGCCGCAGGAAGG + Intergenic
1104039248 12:125118795-125118817 AGGGACAGGCAGCACCAGGAAGG + Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104429775 12:128706546-128706568 CTGCACAGGCAAAATTAGGAAGG + Exonic
1105208553 13:18243279-18243301 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1106355162 13:28975308-28975330 CAGGCCAGGCAGAAGCAAGTCGG - Intronic
1106455151 13:29920434-29920456 CTGGACAGAAACAATCAGGATGG + Intergenic
1106487755 13:30187594-30187616 GTGCACAGGCTGAAGCAAGATGG - Intergenic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107344818 13:39447837-39447859 CTGGAAAGTGAGAAACAGGAAGG + Intronic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1108084352 13:46769673-46769695 AGGGACAGGCACAAGCAGGACGG - Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1110284629 13:73735187-73735209 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1111883235 13:93985327-93985349 CTTGAGAGGCTGAGGCAGGAAGG + Intronic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112590269 13:100757073-100757095 CTGGCATGGCAGAAGCAGAAGGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113192590 13:107767340-107767362 TTGGACATACAGCAGCAGGAGGG - Intronic
1113681652 13:112248704-112248726 GTGGAAAGACAGAAGCATGATGG - Intergenic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1114519751 14:23325721-23325743 CTGGACAGGAGCAGGCAGGAGGG - Exonic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1114929550 14:27450631-27450653 CTGGCCAGGCTGAATCATGAAGG - Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115123275 14:29962541-29962563 TTGGACAGGCACAGACAGGATGG - Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115618534 14:35119443-35119465 CTCGAGAGGCTGAAGCAGGGAGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117171717 14:53107431-53107453 CTGGGCAGGATGGAGCAGGATGG + Intronic
1117381203 14:55165413-55165435 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1117530105 14:56652388-56652410 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1117705675 14:58464850-58464872 CTGGGCAGGATGGAGCAGGACGG + Intronic
1118214772 14:63798499-63798521 CTCGAGAGGCTGAGGCAGGAGGG - Intergenic
1118358299 14:65034203-65034225 CTGTCCAGACTGAAGCAGGAGGG - Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1121088725 14:91166725-91166747 CTTGGCAGGCTGAAGCCGGAGGG + Intronic
1121319181 14:92981200-92981222 CTGGTCAGGAAGAAATAGGATGG - Intronic
1121405193 14:93715578-93715600 GTGGCCAGGCAGAAACTGGAGGG + Intergenic
1121739822 14:96243463-96243485 CTGGAGAGCCAGAACCTGGAGGG + Exonic
1121845506 14:97169032-97169054 GAGGACAGGCAGCAGAAGGAGGG - Intergenic
1121960231 14:98252964-98252986 TGGGACAGAGAGAAGCAGGAGGG + Intergenic
1122037250 14:98957716-98957738 GTGGACAGGAAGAAGCTGGCCGG + Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122092351 14:99348902-99348924 CAGGACAGGGGGAAGCAAGAAGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122501309 14:102201985-102202007 AGAGACAGGCAGAGGCAGGAAGG - Intronic
1122971369 14:105153568-105153590 CTGGAGAGGCGGCGGCAGGAAGG + Intronic
1123025556 14:105422056-105422078 CTGCACACGCAGAAGCAGTCTGG - Intronic
1123473757 15:20572494-20572516 GTGGGCAGGCAGGAGCAGGGGGG + Intergenic
1123644252 15:22427859-22427881 GTGGGCAGGCAGGAGCAGGGGGG - Intergenic
1123734057 15:23167505-23167527 GTGGGCAGGCAGGAGCAGGGGGG + Intergenic
1124284560 15:28388816-28388838 GTGGGCAGGCAGGAGCAGGGGGG + Intronic
1124298137 15:28522798-28522820 GTGGGCAGGCAGGAGCAGGGGGG - Intronic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1125679476 15:41522011-41522033 ATGGCCTGGCAGAAGCAGGCTGG + Intronic
1125744546 15:41989553-41989575 CTGCACATGAAGCAGCAGGACGG + Intronic
1125882642 15:43207677-43207699 CTGGACAGGCAGAAGCTCAGAGG + Intronic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1126015199 15:44344015-44344037 CTGGATAGGCTGAGGCGGGAGGG + Intronic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126410122 15:48364834-48364856 CTGGAGAGGCTGAACCAGCAGGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127271698 15:57407563-57407585 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128091510 15:64922123-64922145 AGGGACAGGCAGAGGCAGGTTGG - Intronic
1128308479 15:66615546-66615568 ATGGACAGGCAGATGATGGAAGG + Intronic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128706073 15:69838164-69838186 TTGGACAGGCAGGAGCAGAGAGG - Intergenic
1128793120 15:70447751-70447773 CTGGACAGGCTGGAGCAAGTGGG + Intergenic
1129329410 15:74819285-74819307 CTGGACAGGTAAGAGCAGAAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130119874 15:81038587-81038609 CAGCACTGACAGAAGCAGGAGGG + Intronic
1130415771 15:83693387-83693409 CTGGCCAGGCTGGAGCTGGAGGG + Intronic
1131426438 15:92348924-92348946 TCAGACAGGCAGAAGCAGGTGGG - Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132788157 16:1669725-1669747 CTGGGCAGGCAACAGCAGCAGGG - Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134776610 16:16859006-16859028 CTCGGGAGGCTGAAGCAGGAGGG - Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136009880 16:27356604-27356626 CTGGCCAGGGATAAGCAAGATGG + Intronic
1136416758 16:30108773-30108795 CTGGCCAGGCCCAACCAGGAGGG - Intronic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1137053972 16:35734764-35734786 CTGGAAAGCGACAAGCAGGAAGG - Intergenic
1137290438 16:47048867-47048889 GAGGCCAGGCAGCAGCAGGAAGG + Intergenic
1137370831 16:47904304-47904326 CTGGACACACTGAAGCAGAAAGG - Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138588127 16:57984901-57984923 CGGGCCAGGCAGAAACAGGGCGG + Intronic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139613674 16:68076211-68076233 CTTGGCAGGCGGAATCAGGATGG + Intronic
1140711482 16:77682258-77682280 CTCAAAAGGCCGAAGCAGGAGGG + Intergenic
1140733826 16:77880262-77880284 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143503526 17:7351996-7352018 CTGGACTGGCAGACGCTGGCGGG - Intronic
1143659553 17:8316096-8316118 CTGGAAGGGCAGTAGCAGGAAGG - Exonic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1144043224 17:11431231-11431253 CTGGACAGTCAGCAGCAGCGAGG - Intronic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1144852067 17:18248884-18248906 CTGGACAAGAAGGGGCAGGAAGG + Intronic
1145018093 17:19411814-19411836 AGGGACAGGAAGAAGCAGGTGGG + Intronic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1145777840 17:27541605-27541627 CTTGACTGGTACAAGCAGGATGG - Intronic
1146396588 17:32472777-32472799 TTTGGGAGGCAGAAGCAGGAGGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147017921 17:37507268-37507290 ATGGACTGGCAGCAGCAGGGAGG + Intronic
1147256467 17:39185008-39185030 ATGGCCAGGGAGAACCAGGAAGG + Intronic
1147363196 17:39944199-39944221 CAGGACAGGCAGGTGCTGGAAGG - Exonic
1147542199 17:41369725-41369747 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147545412 17:41397514-41397536 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147596904 17:41723465-41723487 TTGGCCAGGCAGCAGAAGGAGGG + Exonic
1147854422 17:43468092-43468114 CTGGGCAGGCAGAATCAGCTGGG - Intergenic
1148905067 17:50906804-50906826 CTGGGCGGGCAGAGGCAGAAGGG - Intergenic
1149994184 17:61398312-61398334 CGGGACCGGCGGAAGCAGTATGG - Intergenic
1151490266 17:74428707-74428729 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151850554 17:76687229-76687251 CAGCACAGCCTGAAGCAGGAGGG - Intronic
1152008478 17:77696724-77696746 ATGGACAGGAAAAAGCAGGGGGG + Intergenic
1152077906 17:78169942-78169964 CTGGCCAGGCTGAACCAGGGAGG + Intronic
1152198189 17:78929802-78929824 CAGGACAGACAGGAGCACGAGGG + Intergenic
1152286014 17:79413777-79413799 CTGGCCAGGCCGCAGAAGGATGG - Intronic
1152485193 17:80586547-80586569 CGACACAGGCAGAAACAGGAAGG - Intronic
1152760034 17:82103014-82103036 CTGGACAGGCTGACCCAGGCAGG + Intronic
1153273560 18:3346892-3346914 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153460564 18:5328276-5328298 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1153707138 18:7757530-7757552 CTGGGCAGCCAGCAGCAGGTGGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1158141249 18:54258760-54258782 GTAGGCAGGCAGATGCAGGATGG - Intergenic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1160200886 18:76794298-76794320 GGGGACAGGAAGAAGCAGCATGG - Intergenic
1160338929 18:78069890-78069912 GTGGACAGGCAGAAGCCAGTAGG - Intergenic
1160855332 19:1214740-1214762 CTGCACAGGCAGCAGGAGGTGGG + Intronic
1160947440 19:1650311-1650333 ATGGACAGGGAGAAACAGGGAGG + Intronic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162029294 19:7910430-7910452 CTGCACAGGCAGGGACAGGAGGG - Intronic
1162391011 19:10390264-10390286 CTGAACAGGCAGCAGCCAGAGGG - Intergenic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1163050499 19:14679747-14679769 GTGGAAAGGCTGAAGCAGAAGGG - Intronic
1163181972 19:15610512-15610534 CTCGAGAGGCTGAGGCAGGAAGG + Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163478976 19:17543339-17543361 CTGGTCAGCCAGCTGCAGGAAGG - Exonic
1163676007 19:18655659-18655681 CTGGACATGGAGAGCCAGGATGG + Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165571239 19:36776495-36776517 CTCGGGAGGCTGAAGCAGGAGGG - Exonic
1165855611 19:38878041-38878063 CTGCCCAGGCAAGAGCAGGAAGG + Intronic
1165898795 19:39158771-39158793 CTGGACTGGGAGACCCAGGAGGG - Intronic
1166066967 19:40365843-40365865 CTGGACAGGCTGAACGAGGGTGG - Exonic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1167109591 19:47451414-47451436 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168168875 19:54573538-54573560 CTGGAAGGGCAGACGCAGGAGGG + Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925575149 2:5352465-5352487 GTGGACAGGCAGCAGCTGCAAGG + Intergenic
925798315 2:7570510-7570532 CAGGGCAGGCAGCAGCAAGAAGG + Intergenic
926043532 2:9693250-9693272 CTGGACAGGCATCAGGAGGCTGG + Intergenic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927684670 2:25161983-25162005 GTTGCCAGGCAGAAGCATGAAGG - Intronic
928127058 2:28624204-28624226 AGGGACAGGAAGGAGCAGGAGGG - Intronic
928138212 2:28704788-28704810 CTGGGCTGTCAGAAGCATGATGG + Intergenic
928194139 2:29202156-29202178 GTGAACAGCCAGAGGCAGGAAGG - Intronic
929091494 2:38221950-38221972 CAGGACAGGAGCAAGCAGGATGG + Intergenic
929847209 2:45542177-45542199 CTGAACAGGCTGAGGCAGCAGGG + Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930321008 2:49854456-49854478 CTCGAGAGGCTGAAGCAGAACGG + Intergenic
930520207 2:52456410-52456432 CTAGACTGGTAGAAGCAAGATGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931696399 2:64873786-64873808 GTACACAGGCAGAAGCAGGCTGG - Intergenic
932512176 2:72303851-72303873 GTGGTCAGGCAGGGGCAGGATGG + Intronic
933785602 2:85838761-85838783 CTGCACAAGCAGTTGCAGGAAGG + Intergenic
934024744 2:87992233-87992255 CTCCACAGGCACAGGCAGGAAGG - Intergenic
934615486 2:95768110-95768132 CTAGACAGCCAGAGGCAGGCAGG + Intergenic
934645415 2:96056448-96056470 CTAGACAGCCAGAGGCAGGCAGG - Intergenic
934838819 2:97612537-97612559 CTAGACAGCCAGAGGCAGGCAGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
936062759 2:109306420-109306442 CTGCAAGGGCAGCAGCAGGATGG - Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936471748 2:112805048-112805070 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
936479213 2:112869340-112869362 CATGACAGGCAGCACCAGGAAGG - Intergenic
936650461 2:114420809-114420831 AGGGACAGGGAGAAGCAGAAAGG - Intergenic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
938012227 2:127838063-127838085 CTCGAGAGGCTGAGGCAGGAAGG - Intergenic
938576015 2:132605529-132605551 CAGGCCAGCGAGAAGCAGGAAGG - Intronic
938580798 2:132645078-132645100 CTGGGCAGACACGAGCAGGAGGG - Exonic
939095425 2:137828121-137828143 CTGGACTGGAAGCAGGAGGAGGG + Intergenic
939551441 2:143620565-143620587 CTTGGCTGGCAGAAGCAGAAAGG - Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941278319 2:163518333-163518355 CTTGAAAGACTGAAGCAGGAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941587244 2:167375917-167375939 CTGAACAGGCAAAAACTGGAAGG - Intergenic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942133141 2:172900094-172900116 CTCGAGAGGCAGAGGCAGAATGG + Intronic
942339794 2:174931898-174931920 CTGGTCAGGCTGAAGCAGAATGG + Intronic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
943038835 2:182779499-182779521 CTTGAGAGGCTGAGGCAGGAGGG + Exonic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943639082 2:190339622-190339644 CTGGACAGGATACAGCAGGATGG + Intronic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
944460641 2:199945971-199945993 CTGGACTGGCAGCACCAGTAAGG + Intronic
945621627 2:212146799-212146821 TTGGAAAGGCAGTAGCAGAATGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947359937 2:229336328-229336350 AGGGACAGGCAGACACAGGATGG + Intergenic
947364502 2:229380335-229380357 ACAGACAGGCAGAAGCAGGCAGG + Intronic
947650543 2:231782493-231782515 GGGGACAGGCAGAGGAAGGAAGG - Intronic
947773311 2:232687969-232687991 GTGGACAGGCAGAGTCAGCAAGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947871359 2:233440654-233440676 CAGGCCAGGCAGCAGCAGAAAGG + Intronic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948274379 2:236696945-236696967 CTGGCCATGCAGAAGCATTATGG - Intergenic
948568827 2:238904547-238904569 TTGGACAGTCAGAACCAGCATGG - Intronic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1169477745 20:5947941-5947963 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1169830551 20:9820630-9820652 TTGGACTGGAAGAGGCAGGAAGG - Intronic
1170766359 20:19292668-19292690 GTTGAGAGGCAGAAGCAGGTGGG + Intronic
1171292948 20:23993097-23993119 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1172583322 20:36065178-36065200 CTGGTCAGGCAGAGGCAGATAGG - Intergenic
1172605836 20:36213029-36213051 CTGGCCAGGAAAAACCAGGAGGG - Intronic
1172722631 20:37011968-37011990 CTGGGCAGGCTGAGGCAGGGAGG - Intronic
1172844327 20:37920674-37920696 ATGGACATGCATAAGCAGGGAGG - Intronic
1172857478 20:38016920-38016942 CAAGACAGGCAGAAGCCTGATGG - Intronic
1172858827 20:38031144-38031166 GTGCAAAGGTAGAAGCAGGAAGG - Intronic
1173934999 20:46853599-46853621 CTGGACGGGAAGGAGCAGGGCGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175961372 20:62638343-62638365 CTGGACAGGCAGCTACATGACGG - Intergenic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1178272954 21:31210115-31210137 TTGGGCAGACAGAACCAGGATGG + Exonic
1178699307 21:34819855-34819877 CTGGCGGGCCAGAAGCAGGATGG - Intronic
1178719475 21:34995546-34995568 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179610493 21:42547198-42547220 CCGCACAGGCAGGAGCAGGCTGG - Intronic
1179942142 21:44647233-44647255 CTGGACTGGCAGGAGGAGGTGGG - Exonic
1180081445 21:45489549-45489571 GTGGCCAGGCAGAGGCAGGGAGG + Intronic
1180709161 22:17828136-17828158 CTGGGCCTGCAGAAGCAGGCTGG - Intronic
1180767709 22:18356062-18356084 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1180778599 22:18506328-18506350 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180811324 22:18763636-18763658 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180824007 22:18850811-18850833 CTTGGCAGGCTGAGGCAGGAAGG + Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181064237 22:20298292-20298314 GTGCACAGGGAGAAGCAGGTGGG + Intergenic
1181079399 22:20403912-20403934 CAAGACACGCAGAGGCAGGAAGG - Intronic
1181116377 22:20634696-20634718 GGAGACAGGCAGAAGCAGGAGGG + Intergenic
1181124434 22:20693964-20693986 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181188730 22:21123737-21123759 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181197476 22:21197891-21197913 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181210468 22:21286756-21286778 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181399041 22:22640135-22640157 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181460732 22:23084563-23084585 CTGGCCAGGATGAAGCAGCATGG + Intronic
1181501771 22:23319481-23319503 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181650380 22:24255924-24255946 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181707000 22:24654814-24654836 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1182153380 22:28047277-28047299 CTGGCAGGGCAGAAGCAGGATGG - Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183603052 22:38851113-38851135 CTCGACGGGCAGGAGCAGGGAGG - Intergenic
1184049337 22:41992586-41992608 CTGGACTTTCAGGAGCAGGATGG - Intronic
1184118083 22:42433502-42433524 CTGAGCAGGCAGTAGCAGGGTGG - Intergenic
1184125873 22:42486651-42486673 CTTGGGAGGCTGAAGCAGGATGG + Intergenic
1184967945 22:47995331-47995353 CTTGACAGGCACCAGCAGGTAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184986562 22:48140072-48140094 CTGGACTAGAAGAAGCCGGAAGG + Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185118593 22:48952270-48952292 CTGGGCAGGCAGCAGAAGGCTGG - Intergenic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
1203216478 22_KI270731v1_random:8674-8696 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1203229324 22_KI270731v1_random:96945-96967 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1203274148 22_KI270734v1_random:76714-76736 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950350513 3:12346740-12346762 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
951514196 3:23540169-23540191 CTCGGGAGGCTGAAGCAGGAGGG - Intronic
952329977 3:32355867-32355889 CTAGCGAGACAGAAGCAGGAAGG - Intronic
952729121 3:36620536-36620558 CTGGAAAGTCAGGAGCAGAAAGG - Intergenic
952923963 3:38307924-38307946 TTGGACAGGCAGAAGTGGAAGGG + Intronic
953419426 3:42742903-42742925 CTGGAAAGGGAAAAACAGGAAGG - Exonic
953685377 3:45074103-45074125 TTGGACTGGGTGAAGCAGGATGG + Intergenic
954712532 3:52512258-52512280 CTGGACAGGCAGAAAGATGGGGG + Intronic
954751802 3:52818125-52818147 CTGCCCAGGCAGTGGCAGGATGG + Exonic
955424103 3:58769299-58769321 CTGGACAGAGAGCAGCATGAAGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955898055 3:63721868-63721890 ATGGACAGGAAGAATCAGTATGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957333233 3:78793012-78793034 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957877941 3:86173737-86173759 TTTCACAGGCAGGAGCAGGAAGG - Intergenic
958435225 3:94088043-94088065 CTAGAGATGAAGAAGCAGGAAGG - Intronic
958784385 3:98581672-98581694 CTGGACAGGCAGAAATAAAAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960823355 3:121757718-121757740 CTGGGCAGGAAGCAGTAGGAGGG + Intergenic
961623848 3:128245502-128245524 CTGGACAGGGAGAAGCAGAGTGG + Intronic
962678898 3:137778494-137778516 CTGGGCAGGAGAAAGCAGGAAGG + Intergenic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
965811127 3:172592594-172592616 GTGGTCAGGCGGAAACAGGATGG + Intergenic
965819029 3:172666216-172666238 CGGGACAGGAAGAAGAAGGCAGG - Intronic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
968597298 4:1492018-1492040 CCCGACAGGCAGAAGCAGCCTGG + Intergenic
968925454 4:3544886-3544908 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970585671 4:17512051-17512073 CCGGGCTGGCAGGAGCAGGATGG - Exonic
970798613 4:19945666-19945688 CTAGCCAGGCATAAGCAGGCAGG + Intergenic
970910132 4:21265217-21265239 CAGCACAGGCAAAAGCAGGCAGG + Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
972649088 4:40998910-40998932 CTGGGCGGGATGAAGCAGGATGG + Intronic
973529337 4:51819234-51819256 GGGGACAGCCAGAAGAAGGATGG + Intergenic
974423707 4:61712283-61712305 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975429609 4:74273285-74273307 CTGGACAGCCAGAAGAAAGGGGG + Intronic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
980465006 4:133163216-133163238 CTGGAGAGGAAGGAGCTGGATGG + Exonic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981251844 4:142612212-142612234 CTTCAGAGGCAGAAGCAGCAGGG - Intronic
981925717 4:150137311-150137333 TGGTAAAGGCAGAAGCAGGAGGG + Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983238089 4:165202725-165202747 ATGGACAGGCAGAAGCTGTGGGG + Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
983555993 4:169059685-169059707 CTTGACAGTCAGAAGCAGGCAGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983682719 4:170372105-170372127 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
984325074 4:178241548-178241570 CTTGGCAGCCAGAAGCAGGCAGG + Intergenic
984447358 4:179853649-179853671 CTTCAAAGGCAGAAGCAGGTAGG + Intergenic
984694801 4:182768877-182768899 GGGGTCAGGCAGGAGCAGGAAGG + Intronic
985280313 4:188280018-188280040 CTGGGCAGGAGGAAGCGGGAAGG + Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985827613 5:2204751-2204773 CTGGACAGGAAGCTCCAGGAGGG - Intergenic
985832035 5:2240884-2240906 CTCTCCCGGCAGAAGCAGGAGGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989074952 5:37554812-37554834 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991179183 5:63728931-63728953 TGAGACAGACAGAAGCAGGATGG + Intergenic
991396839 5:66213050-66213072 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
991969248 5:72122739-72122761 ATAGACAGGCATAGGCAGGAAGG + Intronic
993223866 5:85139996-85140018 CTGGACAGGACAAAGCAGGATGG + Intergenic
993225114 5:85159777-85159799 CCAGACAAGCAGAAGCAGTAAGG - Intergenic
993620534 5:90162685-90162707 CTGGGCATGCAGAACCAGGAGGG - Intergenic
994362464 5:98868217-98868239 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
995496397 5:112748887-112748909 CTCTAGAGGCTGAAGCAGGAGGG + Intronic
995597443 5:113763170-113763192 CTGGACATGCAGTTGCAGGCTGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997452665 5:133996094-133996116 CTGGACAGACAGAAGTCAGAGGG + Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
998404501 5:141866472-141866494 CTGGGCAGGGAGAAACATGAGGG + Intronic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999328971 5:150660120-150660142 CTGGAAGGGGAGGAGCAGGAGGG - Intergenic
1000443939 5:161297145-161297167 CTTGACAGGCTGAAGTGGGAGGG + Intronic
1001931033 5:175673088-175673110 CTGGTGAGGTAGAAGCAGGCAGG + Intronic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002960997 6:1914898-1914920 CTGCCCAGGCCTAAGCAGGAGGG - Intronic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003553616 6:7120929-7120951 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1005276466 6:24224585-24224607 CTGGGGTGGCAGAAGCCGGAAGG + Intronic
1005507131 6:26479241-26479263 TTGGACAGGCAGACGATGGAGGG - Intergenic
1005633008 6:27726278-27726300 CTGGACAGGCAGAATCATTGGGG + Intergenic
1005797931 6:29387244-29387266 CTGGATAGGCTGATGCATGAAGG + Intronic
1005991296 6:30904248-30904270 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1006644387 6:35505998-35506020 CTGGACACGGAGAAGAAGGTGGG - Exonic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008243388 6:49141448-49141470 CTCGTGAGGCTGAAGCAGGAGGG - Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010262438 6:73831923-73831945 TTGCACAGGCAGTAGTAGGAAGG - Intergenic
1012169600 6:96002183-96002205 CTGGACGGGCCGATGCAGCAGGG + Intergenic
1012412841 6:98979299-98979321 CAGGACAGGCAGCATCTGGAAGG - Intergenic
1013309226 6:108878328-108878350 CTGGGCTGGCAGGAGCAGGGAGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014747865 6:125221005-125221027 GTGGAGAGGCCAAAGCAGGAAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015697277 6:135995039-135995061 GGGGACATGAAGAAGCAGGATGG - Intronic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1017658275 6:156650240-156650262 CAGGACACGGAGAAGCTGGAGGG - Intergenic
1017996294 6:159534290-159534312 CTGGACCGGCAGGCGCAGGCTGG + Intergenic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1018844406 6:167545771-167545793 CGTGACAGGTGGAAGCAGGAAGG - Intergenic
1018861301 6:167712577-167712599 CTGGCCTGGCAGAATCAGGCCGG - Intergenic
1019020394 6:168913080-168913102 TTGGATAGGCAGGAACAGGAGGG - Intergenic
1019520126 7:1457062-1457084 CTGGGCTGGAAGAGGCAGGAAGG - Intronic
1019680566 7:2346336-2346358 CTGGGGAGGCCGAAACAGGAGGG + Intronic
1019943816 7:4311196-4311218 TTGGAAAGGCAGAAGCAGTTGGG - Intergenic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1022310745 7:29194301-29194323 CTGGACAGGGGGAGGCGGGACGG - Intronic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1023250375 7:38253888-38253910 CTCGAGAGGCTGAGGCAGGAGGG + Intergenic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023750519 7:43367950-43367972 CTGGAGAGGTGGAAGCAGAAGGG - Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023764945 7:43501721-43501743 CTAGGGAGGCTGAAGCAGGAGGG + Intronic
1024553580 7:50584128-50584150 CAGGCCAGGCACAAGCAAGAGGG - Intergenic
1024766260 7:52664475-52664497 CTGGAGTGGCTGGAGCAGGAGGG - Intergenic
1024823893 7:53366533-53366555 CTGGACAGGGAGAACCATGATGG - Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026867956 7:73834909-73834931 CTGGACAGGCTGGAGCAGGCTGG - Exonic
1027585382 7:80050929-80050951 TTGGGGAGGCCGAAGCAGGAGGG + Intergenic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029186702 7:98744236-98744258 CTGAACAGGAGGAAGCAGAAAGG - Intergenic
1029457120 7:100676945-100676967 CTGGACAGGCAGGACCATGCTGG + Intronic
1030797112 7:113802708-113802730 GTTCACAGGCAGATGCAGGAAGG + Intergenic
1030909818 7:115233322-115233344 CTGTCCAGGTAGAAACAGGATGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1033283031 7:140019060-140019082 CTGGACAGGCAGGCATAGGAAGG + Intronic
1033654010 7:143361707-143361729 GTAGCCAGGCAGAAGCTGGAGGG + Intronic
1033664915 7:143431296-143431318 CTGTAAAGGCAGACCCAGGATGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1035394717 7:158527360-158527382 CTGGACACGGAGACGCAGGCTGG - Intronic
1036213334 8:6860242-6860264 GTGGACAGGGAGGAGCAGGGAGG + Intergenic
1036544828 8:9757564-9757586 CTGGGAAGGAAGGAGCAGGAAGG - Intronic
1036945737 8:13092764-13092786 CTCGTCAGGCAGCAGCATGATGG + Exonic
1037704548 8:21308193-21308215 ATTGACAGGAAAAAGCAGGAAGG + Intergenic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1039893115 8:41697657-41697679 CCGGACAGGCTCAGGCAGGAGGG - Intronic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041502043 8:58549673-58549695 CTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042256827 8:66813144-66813166 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
1042342823 8:67698190-67698212 CTGGACAGACATAAGAGGGAAGG - Intronic
1042498127 8:69478551-69478573 TTGGACATGCAGAACCATGATGG - Intronic
1044700570 8:94962152-94962174 CTGGGCAGGAAGAAGTAGAAAGG - Intronic
1045014525 8:97988516-97988538 CTCGAAAGGCTGAGGCAGGAGGG + Intronic
1045733578 8:105268560-105268582 TAGGACAGGCAGGAGCAAGATGG - Intronic
1045895211 8:107208263-107208285 CTAGACAGACACAAGCAGGGCGG + Intergenic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047696004 8:127404433-127404455 CTGGGCTGGCAGATCCAGGAAGG - Intergenic
1047701448 8:127453109-127453131 CAGGACAGGCAGAAACAGACTGG - Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048575001 8:135683343-135683365 CGGGACCGGCAGCAGCAGCAGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048985149 8:139731095-139731117 CTGGGCAGGCAGAACCAAGAGGG + Exonic
1049519311 8:143080159-143080181 CCGGCCAGGCAGATCCAGGAAGG - Intergenic
1049710805 8:144062527-144062549 CTGGCCAGGCAGAGGCTGTATGG - Intronic
1050404075 9:5289069-5289091 CTGAATAGGCAAAAGCTGGAAGG - Intergenic
1050425660 9:5510098-5510120 CTGAATAGGCAAAAGCTGGAAGG + Intergenic
1051191169 9:14515162-14515184 CTGGACAGGTACAAGCATAAGGG + Intergenic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1052349734 9:27446434-27446456 CTTGACAGCTAGAATCAGGAAGG - Intronic
1053169711 9:35869772-35869794 GGGTACAGGCAGCAGCAGGATGG + Exonic
1053379922 9:37640290-37640312 CTGGTAGGGCTGAAGCAGGAGGG + Intronic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053554081 9:39116310-39116332 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1053564444 9:39233714-39233736 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1053800345 9:41760068-41760090 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1053818184 9:41936435-41936457 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1053830226 9:42071616-42071638 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1054108443 9:61080094-61080116 CTGAACAGCCAGGAGCTGGAGGG + Intergenic
1054132706 9:61385322-61385344 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054144853 9:61554767-61554789 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054188772 9:61972220-61972242 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054464545 9:65485724-65485746 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054600333 9:67115839-67115861 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054612414 9:67251031-67251053 CTGAACAGCCAGGAGCTGGAGGG - Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649749 9:67616397-67616419 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054928620 9:70613670-70613692 CTCCACAGGCAGAAACAGCAGGG - Intronic
1056396870 9:86189204-86189226 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1056629353 9:88280397-88280419 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057761732 9:97880055-97880077 CTGGGCAGGTAGAAGCAGACTGG - Intergenic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1058896017 9:109401335-109401357 CTGGATTGGCAGCACCAGGATGG - Intronic
1059398628 9:114054720-114054742 CTGAAAAGGCAAAACCAGGAGGG - Exonic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060888727 9:127174916-127174938 CTGGGCAGGCTGGTGCAGGAGGG - Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061178219 9:129009774-129009796 CTGGACTTGCAGAAGCAGCTGGG - Exonic
1061291043 9:129650451-129650473 CGAGAGAGGCAGAGGCAGGAAGG + Intergenic
1061382577 9:130267051-130267073 CTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1061402558 9:130376369-130376391 GTGGACAGCCAGGAGCAGGCTGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1062690001 9:137836841-137836863 CTGGGCAGGCGGACCCAGGATGG + Intronic
1203779986 EBV:95945-95967 CGGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186050721 X:5592085-5592107 CTGGGCAGGATGGAGCAGGATGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187486621 X:19710218-19710240 CCGGACAGGATGGAGCAGGATGG - Intronic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1187794012 X:22981305-22981327 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1188438474 X:30189864-30189886 CTGTGCAGGCAGCAGCAGAAGGG - Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189025009 X:37385329-37385351 CTGGACAGGAAGCAGAAGGAGGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1194068420 X:89289870-89289892 CAGGACAGGCAAAACCAGAAGGG + Intergenic
1194342538 X:92722335-92722357 CTTGACAGGAAGAAACAGGTAGG + Intergenic
1195720568 X:107863809-107863831 CTAGACAGGCAGAGACAGTAAGG - Intronic
1195797615 X:108668428-108668450 CTGGACCCGGAGAACCAGGAGGG - Exonic
1196187430 X:112759662-112759684 CTGGGCAGGATAAAGCAGGATGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197286264 X:124598705-124598727 GTGGACAGGGAGTAGAAGGATGG + Intronic
1197372593 X:125642877-125642899 CTTGAGAGGCTGAAGCAAGAAGG + Intergenic
1197695643 X:129547119-129547141 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1197758150 X:130010526-130010548 TTGGACTGGCAGAAGTGGGAGGG - Intronic
1198402652 X:136282360-136282382 CTGGCCAGACAGGAGCAGGCAGG + Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199718465 X:150524766-150524788 CTGGGCAGGGAGAAGCAACAAGG - Intergenic
1200722563 Y:6624035-6624057 CAGGACAGGCAAAACCAGAAGGG + Intergenic
1201973468 Y:19820102-19820124 CTGCACAGGCTGTGGCAGGAAGG - Intergenic