ID: 1137401265

View in Genome Browser
Species Human (GRCh38)
Location 16:48156049-48156071
Sequence ATTCCCTCTGCCCACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137401263_1137401265 4 Left 1137401263 16:48156022-48156044 CCTGAGAGGGAACTCTGGCGGGC No data
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401258_1137401265 12 Left 1137401258 16:48156014-48156036 CCACCACACCTGAGAGGGAACTC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401259_1137401265 9 Left 1137401259 16:48156017-48156039 CCACACCTGAGAGGGAACTCTGG 0: 1
1: 0
2: 2
3: 11
4: 159
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401253_1137401265 29 Left 1137401253 16:48155997-48156019 CCATTCAACTGCCACTCCCACCA 0: 1
1: 0
2: 3
3: 23
4: 339
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401254_1137401265 18 Left 1137401254 16:48156008-48156030 CCACTCCCACCACACCTGAGAGG 0: 1
1: 0
2: 3
3: 31
4: 379
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401257_1137401265 13 Left 1137401257 16:48156013-48156035 CCCACCACACCTGAGAGGGAACT 0: 1
1: 1
2: 0
3: 7
4: 132
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data
1137401252_1137401265 30 Left 1137401252 16:48155996-48156018 CCCATTCAACTGCCACTCCCACC 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137401265 Original CRISPR ATTCCCTCTGCCCACATTAA AGG Intergenic