ID: 1137403482

View in Genome Browser
Species Human (GRCh38)
Location 16:48172045-48172067
Sequence TACCAAGGGCTGGTGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 1, 2: 13, 3: 124, 4: 710}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137403482_1137403491 5 Left 1137403482 16:48172045-48172067 CCCCTCCCCACCAGCCCTTGGTA 0: 1
1: 1
2: 13
3: 124
4: 710
Right 1137403491 16:48172073-48172095 TATTCTACTTTCCATCGATATGG 0: 1
1: 0
2: 2
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137403482 Original CRISPR TACCAAGGGCTGGTGGGGAG GGG (reversed) Intronic
901268291 1:7929674-7929696 TGCCAGGGGATGGTGGGGAGAGG + Intronic
902082323 1:13829436-13829458 TACAATAGGCTGGTGGGGAGGGG + Intergenic
902101217 1:13991283-13991305 TACCAGGGCCTGTTGGGGTGTGG + Intergenic
902231947 1:15033560-15033582 TAGCAAGGGCTGGTGGGATGTGG - Intronic
902954548 1:19916196-19916218 TACCAGGGGCTGGTGGACAATGG + Intergenic
903326973 1:22574473-22574495 TGCCAGGGGCTGGCAGGGAGGGG - Intronic
903595244 1:24489136-24489158 TACCAGGGGCTGGGGGAGAGGGG + Intergenic
903647305 1:24903051-24903073 TAACATGGGCCGGTGGGGAGAGG - Intronic
904035668 1:27557267-27557289 GGCCAAGGGCAGGAGGGGAGGGG - Intronic
904145960 1:28391472-28391494 TACCAGGAGCTGGGTGGGAGTGG + Intronic
904207526 1:28864568-28864590 TGCCAAGGGGTGGTGGTGGGTGG + Intergenic
904316968 1:29671793-29671815 TTCCCACGGCTGGTGAGGAGCGG + Intergenic
904412927 1:30335846-30335868 TACTGAGGACTGGTGGGGTGGGG + Intergenic
904442125 1:30538916-30538938 TTCCCACGGCTGGTGAGGAGCGG - Intergenic
904788289 1:32998795-32998817 TACCAAGCGCTGCTGGGCACTGG - Intergenic
904989119 1:34577203-34577225 TACCAAAGGCTGAGGGCGAGGGG - Intergenic
905383785 1:37584636-37584658 TACCAGGGGCTGGGGGAGAGGGG + Intronic
905746516 1:40422936-40422958 TACCCAGAGCAGATGGGGAGAGG - Exonic
905916702 1:41689539-41689561 CACCAAGGGCTTGGGAGGAGTGG + Intronic
905966258 1:42098942-42098964 TACAAGGGGCTGGAGGGGAGGGG + Intergenic
906298842 1:44666697-44666719 TGCCAAGGGCTGGGGGGAGGAGG + Intronic
906675024 1:47687322-47687344 AGCCAAGGGCTAGTGGGGTGTGG - Intergenic
907128327 1:52072483-52072505 TACCAAGGGCTGGGGTAGAGGGG - Intronic
907308062 1:53524604-53524626 CACTAAGGGCAGGTGGGAAGTGG + Intronic
907634844 1:56123931-56123953 CACCAGGGCCTGTTGGGGAGTGG - Intergenic
907846822 1:58216185-58216207 CACCAAGGCCTGTTGGGGGGTGG - Intronic
908172459 1:61519651-61519673 TACCAGGGGCTGGAGAGGCGGGG - Intergenic
909041303 1:70655389-70655411 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
909367733 1:74847356-74847378 TACCATGGGCTGGGGGGAGGAGG + Intergenic
909624263 1:77698538-77698560 TGCCAAGGGCTGGAGTGCAGTGG + Intronic
909638534 1:77846142-77846164 TGCCAAGGGCTGGGGGGTAAAGG - Intronic
909676941 1:78249203-78249225 TCAGCAGGGCTGGTGGGGAGTGG + Intergenic
909723519 1:78806115-78806137 TGCCAGAGGCTGGTGGAGAGAGG - Intergenic
909734180 1:78935388-78935410 CACCAGGGCCTGCTGGGGAGTGG + Intronic
910633000 1:89375956-89375978 TACGAGGGGCTAGTGGAGAGGGG - Intronic
910920828 1:92344730-92344752 TACCAAGGGTTGGTGAGGATGGG - Intronic
911925658 1:103828454-103828476 TGCCAGGGGTTGGAGGGGAGAGG - Intergenic
913260537 1:116993851-116993873 TGCCAAGAGCTGGGGGGGAGGGG + Intergenic
914013908 1:143800111-143800133 CTCCAAGGGTTGCTGGGGAGAGG - Intergenic
914163915 1:145161086-145161108 CTCCAAGGGTTGCTGGGGAGAGG + Intergenic
914356521 1:146889744-146889766 TACCAAGGGCTGGAGAGGATGGG + Intergenic
915575532 1:156774080-156774102 TACCAGGGGCTGGGGGGAGGTGG + Intronic
915704700 1:157832987-157833009 TTCCTGGGGCTGGTGGGTAGAGG - Intronic
915991305 1:160519777-160519799 TGCCAGGGGCTGGGGGGGAGGGG + Intronic
916068326 1:161154270-161154292 TAAGGAGGGATGGTGGGGAGAGG + Intronic
916854770 1:168738185-168738207 CACCAAGGCCTGGTTGGCAGTGG + Intergenic
916880412 1:169015177-169015199 CAGCAAGTGCTGGTGGGGACAGG - Intergenic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
917073718 1:171181243-171181265 TGCCAAGGGCTGGGAGTGAGGGG + Intergenic
917267851 1:173240818-173240840 TATCAAGTGCTGGTGAGGATAGG - Intergenic
917541675 1:175920631-175920653 TACCAAGGGGAGGTGGGGAAAGG + Intergenic
918096239 1:181336728-181336750 TGCCAAGGGCTGGGGGAGGGAGG - Intergenic
918231400 1:182536441-182536463 TACCAAAGGTTGGTGAGGATGGG - Intronic
919214954 1:194541214-194541236 CACCAAGGCCTCTTGGGGAGTGG - Intergenic
919353125 1:196485281-196485303 TACCAAGGCCTGTTGGGGATTGG + Intronic
920968222 1:210719530-210719552 CACCAGGGCCTGTTGGGGAGTGG + Intronic
920995088 1:210982425-210982447 TACCGGGGACTGGTGTGGAGTGG - Intronic
921292482 1:213671356-213671378 TACCAGGGGCTGGGGTGGGGAGG + Intergenic
921411643 1:214842425-214842447 TGCCAGGGGCTGGGGGGAAGGGG - Intergenic
921507309 1:215988189-215988211 TACCAAGGTCTGGGTGGAAGGGG - Intronic
921577300 1:216851415-216851437 TACCATTACCTGGTGGGGAGTGG - Intronic
921925242 1:220705702-220705724 GACCAGGGGCTGGCAGGGAGAGG + Intergenic
922520477 1:226246422-226246444 TACCCAGGGCAGGATGGGAGTGG - Intronic
923086513 1:230707014-230707036 TAGCAAGGGCTGCTGAGGAATGG - Intronic
923338949 1:232991775-232991797 TCCTGAGGGCTGGAGGGGAGTGG - Intronic
923763804 1:236873263-236873285 TACCAGGGGATGGAGTGGAGAGG + Intronic
923943542 1:238856415-238856437 CACCAGGGCCTGGTGGGGAGTGG + Intergenic
924204050 1:241692909-241692931 CACCAAATGCTGGTGGGGTGTGG + Intronic
924272891 1:242352212-242352234 TACCAGAGGCTGGTGGGTAGAGG - Intronic
1063192424 10:3708754-3708776 TGGGAAGGGCTGGTGGAGAGGGG - Intergenic
1063505726 10:6597639-6597661 TACCAAGGACTGGAGGTGGGGGG - Intergenic
1063940208 10:11120723-11120745 TTGCAAGGGCTGGTGAGGGGTGG - Intronic
1064911601 10:20407701-20407723 TACCAGGGGCTTATGGGAAGAGG - Intergenic
1065158390 10:22894234-22894256 TTCCATGGGCTGGTGGTGGGTGG + Intergenic
1065500110 10:26372677-26372699 TGCTGAGGGCTGATGGGGAGAGG - Intergenic
1065622145 10:27593268-27593290 CACCAGGGGCTGTTGGGGGGTGG + Intergenic
1065936100 10:30521743-30521765 CACCAAGGGCTGGGGAGGAGGGG + Intergenic
1066072224 10:31829317-31829339 TACCAAGGGCTGGGGGATGGAGG + Intronic
1066473627 10:35723624-35723646 AACCAAGGGTTGGAGGGGAGTGG - Intergenic
1066711823 10:38244451-38244473 TACCAGAGGCTGGTGGGTAGAGG + Intergenic
1067001862 10:42622678-42622700 TACCACAGGCTGGTGGGAATGGG + Intronic
1067106716 10:43371520-43371542 CACCCAGGGCTGTTGGGGAGGGG - Intergenic
1067182039 10:43995443-43995465 AACCAAGGGATTGGGGGGAGAGG + Intergenic
1067191414 10:44071366-44071388 GACTTAGGGATGGTGGGGAGGGG - Intergenic
1067238727 10:44472777-44472799 CACCAGGGGCTGGGGGAGAGTGG - Intergenic
1068000481 10:51328135-51328157 TACCAGGGGCTGGAGTGGGGAGG - Intronic
1068107326 10:52635053-52635075 CACCAGGGCCTGTTGGGGAGTGG - Intergenic
1068649483 10:59505656-59505678 TACCAAAGGTTGGTGGGAGGGGG + Intergenic
1068870234 10:61935547-61935569 TGCCAGGAGCTGGTGGGGAGTGG + Intronic
1068996544 10:63212153-63212175 TGCCAAGGGCTGGCAGGGAAGGG + Intronic
1069086896 10:64151125-64151147 TACCAGAGGCTGGTGGGCAGAGG - Intergenic
1070429115 10:76318457-76318479 CAGCAGAGGCTGGTGGGGAGGGG - Intronic
1070580716 10:77717147-77717169 TCCCCAGGGCTGGTGGTGATGGG + Intergenic
1071043846 10:81349479-81349501 TACCAGGGGCTGGAGCGGGGAGG - Intergenic
1071287216 10:84160014-84160036 TACCAGGGGCTGGTGGGTGGGGG + Intergenic
1071308571 10:84322250-84322272 TCCCAGGGGCTGGGGGAGAGGGG + Intergenic
1071383293 10:85093393-85093415 TACCAGCAACTGGTGGGGAGGGG - Intergenic
1071516493 10:86301124-86301146 TCCCATGGGCTGGTGGGTGGGGG - Intronic
1071889578 10:89988386-89988408 AACCAGGGCCTGTTGGGGAGTGG - Intergenic
1072968005 10:99991428-99991450 TGCCTAGGGCTGGAGAGGAGAGG - Intronic
1073007047 10:100332334-100332356 TACCAGAGGCTGGGGGTGAGGGG + Intergenic
1073073108 10:100807290-100807312 TACCATGGGCTGTGGGTGAGGGG - Intronic
1073257870 10:102166287-102166309 TGCCAAGGGCTGGGGAGGAGGGG - Intergenic
1073273173 10:102284422-102284444 TACCAGGGGCTGGAGGGGAAGGG - Intronic
1074177439 10:111023232-111023254 TGCTAAGGTGTGGTGGGGAGGGG - Intergenic
1074433030 10:113409484-113409506 TGCCCATGGCTGGTGGGGAAGGG + Intergenic
1074470781 10:113724843-113724865 TGCCAGGGGCTGGAGGGAAGGGG - Intronic
1074715622 10:116215882-116215904 CTCCAGGGGCTGGTGGGGAGAGG - Intronic
1075560900 10:123467765-123467787 TTCCCAGGCCCGGTGGGGAGGGG + Intergenic
1075730292 10:124631747-124631769 GACCCAGGGCTGGTGCAGAGGGG - Intronic
1076061313 10:127416413-127416435 TACAAAGGGCTCATGGGCAGAGG - Intronic
1076061456 10:127417145-127417167 TACCAAGGGCTCTTGGGCATGGG + Intronic
1076227559 10:128792609-128792631 AGTCAAGGGCTGTTGGGGAGAGG + Intergenic
1076342849 10:129761428-129761450 CACCAAAGGCTGGTGGGGGAGGG - Intronic
1076747363 10:132521193-132521215 TAGCGAGGGCTGGGGCGGAGGGG + Intergenic
1076879000 10:133230895-133230917 TGCCGAGGGCTGCGGGGGAGGGG + Intronic
1077258991 11:1605329-1605351 TAGCATGGGCTGATGGGGAGGGG + Intergenic
1077381800 11:2246817-2246839 TACCTAAGGCTGGGGAGGAGGGG + Intergenic
1078085098 11:8229224-8229246 TTGCCAGGGCTGGAGGGGAGAGG - Intronic
1078309067 11:10220286-10220308 AATCATGGGCTGGTGGGGCGAGG - Intronic
1078583138 11:12555484-12555506 TGCCAAAGGCTGGGGGGGTGGGG + Intergenic
1078946629 11:16075641-16075663 CACCAAGTCCTGTTGGGGAGTGG + Intronic
1079371609 11:19858214-19858236 TACCAGGGGCTGGTGGATGGGGG - Intronic
1079397447 11:20077398-20077420 TCCCAAAGAGTGGTGGGGAGTGG + Intronic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1080786564 11:35480224-35480246 TGACATGGGGTGGTGGGGAGGGG - Intronic
1081113870 11:39173073-39173095 TAGCAAGTGAAGGTGGGGAGAGG - Intergenic
1081225668 11:40519075-40519097 CACCAGGGCCTGTTGGGGAGTGG + Intronic
1081243156 11:40731356-40731378 GAGCAAGGGGCGGTGGGGAGAGG - Intronic
1081516835 11:43840545-43840567 TGCCAGGGGCTGGAGGGAAGGGG - Intronic
1081603181 11:44509490-44509512 GATCAGGGGCTGGTGGGGAGGGG + Intergenic
1081873663 11:46394615-46394637 CTCCAACGGGTGGTGGGGAGAGG + Intergenic
1082672123 11:56046870-56046892 TACCAGGGTCTGTTGGGGGGTGG + Intergenic
1082902768 11:58273754-58273776 TGCAAAGGTCTGGTGGTGAGAGG - Intergenic
1083519525 11:63295634-63295656 TACCAAGGGCTTGTCTGCAGGGG + Intronic
1083817306 11:65142106-65142128 TGCCAAGGGCTGGTGGCGTGAGG + Intergenic
1083952547 11:65965037-65965059 CGCCCATGGCTGGTGGGGAGAGG - Intronic
1084494339 11:69495398-69495420 TAGCAGGGGCTGGTGAGGTGAGG - Intergenic
1084653014 11:70500067-70500089 CACCCAGGGCTGGTGTGGAGTGG - Intronic
1084669452 11:70596506-70596528 TAGCAAGGCCTGGTGGGGGTGGG - Intronic
1084792757 11:71485193-71485215 TACCACTGGCAGGAGGGGAGAGG - Intronic
1084802549 11:71554698-71554720 TAGCATGGGCTGATGCGGAGGGG - Intronic
1085070993 11:73545424-73545446 TGCCTAGGGCTGGTGGAGAAGGG + Intronic
1085204068 11:74719855-74719877 GACCCAGGGCTGGAGGTGAGTGG - Intronic
1085794505 11:79525669-79525691 TGCCAAAGGCTGAGGGGGAGGGG - Intergenic
1086666050 11:89483589-89483611 TACCAGGTGCTGGTGGGGGTGGG + Intronic
1087011474 11:93518105-93518127 TTCCAGGGGCTGGAGGGAAGAGG - Intronic
1087016628 11:93560416-93560438 TGCCAGGGACTGGTGGGGAGTGG - Intergenic
1087196425 11:95308544-95308566 TACCAGGGGCTGGGGTGGGGAGG - Intergenic
1088474989 11:110226458-110226480 CACCAAGGACTGGGGAGGAGGGG + Intronic
1089214747 11:116828990-116829012 GAACAAGGTCTGGTGAGGAGAGG - Intergenic
1089495720 11:118907855-118907877 TAATTAGGGCTGGAGGGGAGGGG + Intronic
1089587674 11:119520573-119520595 TCCCAAGGGCTGTTTGGAAGTGG + Intergenic
1089734925 11:120543964-120543986 TGTCAGGGGCTGGTGGGGAGGGG + Intronic
1090067915 11:123519143-123519165 TACCAAGGACAGGAAGGGAGGGG + Intergenic
1090148262 11:124351821-124351843 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1090152500 11:124400481-124400503 TACCAGAGGCTGGGGGTGAGGGG - Intergenic
1090391389 11:126390847-126390869 TGCCAAGGGCTGGGGGGAGGCGG - Intronic
1090819365 11:130327287-130327309 TACTAGGGGCTGGGGGGCAGGGG - Intergenic
1091405797 12:208678-208700 TGCCAAGGGCTGGCAGGGAGAGG + Intronic
1091574446 12:1720326-1720348 TTCCATGGACTGGTGGGCAGGGG + Intronic
1092099516 12:5871674-5871696 TTCCATGGACTGGTGGGTAGGGG - Intronic
1092284155 12:7119211-7119233 TCCCAAGGGCTGGGGGGTAGGGG + Intergenic
1092537803 12:9404132-9404154 TCCCAAGAGCTGGGGGGAAGTGG - Intergenic
1092675079 12:10907638-10907660 GAAAAAGGGCTGGAGGGGAGAGG + Intronic
1092838233 12:12512485-12512507 TACCAGGGGCTGGAGGGCTGGGG - Intronic
1093550060 12:20398980-20399002 TACCAGGGGCTGGGAGGAAGAGG - Intronic
1093956694 12:25228594-25228616 TACCAGGGGCTGGGGGAGGGAGG + Intronic
1094706249 12:32916698-32916720 TGCCAGGGGCTGGAGGGGAAGGG + Intergenic
1095715196 12:45337631-45337653 TAGCAGGGGCTGGAGGTGAGAGG + Intronic
1095857924 12:46881696-46881718 TACCAGGGCCTGTTGGGGAGTGG + Intergenic
1096019046 12:48307000-48307022 TACCAAAGGCTGGAGTGCAGTGG - Intergenic
1096536137 12:52276015-52276037 TCCAAAGGGTAGGTGGGGAGGGG - Intronic
1097083731 12:56452189-56452211 TACCAGGGGCTGATGGGGGTGGG - Intronic
1097152159 12:56987111-56987133 TACCCAGGGCTGCTGGGAAGGGG + Intergenic
1097270272 12:57769761-57769783 TACAAGGGCCAGGTGGGGAGGGG - Exonic
1097626803 12:62010823-62010845 GACGAAGGGCTGCTGGGCAGAGG - Intronic
1100276888 12:93079736-93079758 TACCAGGGGCTGGGGGGAAGAGG + Intergenic
1100424406 12:94469889-94469911 TGCCAGGGGCTGGTGGGGTGGGG + Intergenic
1101136074 12:101744414-101744436 CAGCATGGGCTGGTGGGGACAGG + Intergenic
1101926137 12:108972849-108972871 TACCAAGGGCTGCAAGGTAGAGG + Intronic
1102696595 12:114804488-114804510 TGCCTAGGGCTGGAGGGAAGAGG - Intergenic
1103065793 12:117896357-117896379 TGCCAGGGGCTGGTGGGAGGTGG + Intronic
1103321306 12:120094082-120094104 CACCACGGGGTGGAGGGGAGGGG + Exonic
1103536735 12:121638619-121638641 TACCTAGGGCAGGAGGGGTGAGG + Intronic
1103540376 12:121662092-121662114 TAGCAGGGGCTGGTGGGGTGGGG + Intronic
1103677220 12:122665401-122665423 TACTAGGGACTGGCGGGGAGGGG - Intergenic
1103843660 12:123886351-123886373 TGCCAGGAGCTGCTGGGGAGGGG + Intronic
1103922838 12:124408062-124408084 TACCAAGGCGTGGCGGGGCGCGG + Intronic
1103977983 12:124716148-124716170 TACCAAGGGCTGCCGAGGGGTGG + Intergenic
1103997378 12:124839216-124839238 TGCCAGGGGCTGGGGGAGAGGGG - Intronic
1104189616 12:126467368-126467390 TCCCAAGGGGTGGTGGGAAGGGG + Intergenic
1104718474 12:131031649-131031671 TACAATGGGATGGTGGAGAGGGG - Intronic
1105287807 13:19021131-19021153 TACCAGGGGCTGGGGGAGAAGGG + Intergenic
1105370834 13:19800512-19800534 TACCAGGGGCTGGAGGGAGGCGG - Intergenic
1105410387 13:20166993-20167015 TACCTAGGGGTGGTGAGGAGTGG - Intergenic
1105551487 13:21400571-21400593 TGCCAGGGGCTGGTGTGGTGTGG + Intronic
1106111165 13:26778396-26778418 TGCCAGGGGCTGGTGGGAGGGGG - Intergenic
1106561792 13:30852972-30852994 TATCAAGGGCTGGGGGGAGGGGG - Intergenic
1106816037 13:33408314-33408336 TGCCAGGGGCTGGAGGGGAGAGG - Intergenic
1106943356 13:34800323-34800345 TAGCTTGGGCTGGTGAGGAGGGG - Intergenic
1106945680 13:34824959-34824981 TTCCAGGGGCTGGGGGAGAGGGG - Intergenic
1107316794 13:39141089-39141111 TACCAGGGCCTGTTGGGGGGTGG - Intergenic
1108194796 13:47982405-47982427 TACCAGGAGCTGGAGGGAAGTGG + Intronic
1108789741 13:53953948-53953970 TACCAGGAGCTGGTGGGAGGGGG - Intergenic
1109396080 13:61761574-61761596 TAAAAAGTGCTGGTGTGGAGAGG + Intergenic
1109521138 13:63511950-63511972 CGCCAAGGGCTGGTGGGAAGTGG + Intergenic
1110654190 13:77977181-77977203 TACCAAGGGATTGGTGGGAGGGG - Intergenic
1111256326 13:85673975-85673997 TACCAGAGGCTGGTGGAGAAGGG + Intergenic
1112339277 13:98538968-98538990 GAGTCAGGGCTGGTGGGGAGGGG + Intronic
1112412977 13:99179670-99179692 TGCAAAGGGCTTGTGGGAAGGGG + Intergenic
1112493421 13:99886838-99886860 TACCATTTGCTGGAGGGGAGAGG - Intronic
1112748872 13:102559965-102559987 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1113565702 13:111318484-111318506 CACCAAGGGCTTCTAGGGAGAGG - Intronic
1113582088 13:111437128-111437150 TAGCCAGGCCTGGAGGGGAGGGG - Intergenic
1113647200 13:112006956-112006978 TGCCAGGGGCTGGCAGGGAGGGG + Intergenic
1113681993 13:112251038-112251060 TGCCCAGCGCTGGTGGGAAGTGG - Intergenic
1114164242 14:20202802-20202824 AACCTGGTGCTGGTGGGGAGGGG + Intergenic
1114734656 14:25031972-25031994 TTCCAAGAGAAGGTGGGGAGTGG + Intronic
1114795938 14:25714726-25714748 TACCAAGGACTGATGGTGTGAGG + Intergenic
1115316099 14:32026539-32026561 TACCAAGGGGTGATGGGGTAGGG + Intergenic
1115482939 14:33879939-33879961 TACCAAGGGCTAGGGGGAAAGGG + Intergenic
1116752952 14:48909901-48909923 CACCAAGGCCTGTTGGGGGGTGG + Intergenic
1117232376 14:53733942-53733964 TACCAGGGACTGGTGAGGAGAGG + Intergenic
1117369677 14:55065551-55065573 AACCAAGGGCAAGTGGGGTGGGG - Exonic
1117517321 14:56514732-56514754 TGCCAGGGGCTGGTGGGAGGAGG + Intronic
1117617713 14:57550745-57550767 TACCAGAGCCTGTTGGGGAGTGG - Intergenic
1117811094 14:59548282-59548304 TGCCAAGGGCTGGTGAGGGAGGG + Intronic
1119348955 14:73948769-73948791 TGCTTAGGGCTGGTGGGGTGGGG - Intronic
1119409953 14:74424414-74424436 TTCCAGGTGCTGTTGGGGAGGGG + Intronic
1119426266 14:74536307-74536329 TACCAGGGCCTGGGGGAGAGGGG + Intronic
1119455062 14:74748117-74748139 TCCCAATGGCAGGTGGGGCGTGG + Intergenic
1119468146 14:74875974-74875996 TGCCCAGGGCTGGTGAAGAGTGG - Intergenic
1119550658 14:75511179-75511201 TTCCAAGAGCTGAGGGGGAGAGG + Intergenic
1120138866 14:80904322-80904344 TACCAGAGGGTGGCGGGGAGAGG + Intronic
1120725298 14:87932298-87932320 TACCAGGGGCTGTTGGGGGGTGG + Intronic
1121233484 14:92375787-92375809 TGTCAAGGGCTGTGGGGGAGGGG + Intronic
1121911950 14:97799746-97799768 TACCAGAGGCTGGAGGGCAGGGG + Intergenic
1122191675 14:100049808-100049830 TGCCTAGGGCTGGTGAGGAGAGG - Intronic
1122329230 14:100901780-100901802 TGCCCAGGGCTGGTGGGGGGAGG - Intergenic
1122358651 14:101142623-101142645 CACCAAGGCCTGTTGGGGGGCGG - Intergenic
1122508933 14:102250342-102250364 TGCCAAAGGCTGGGGGGGAGTGG + Intronic
1122794640 14:104200093-104200115 TTCCCAGGGCTGGTGGGGCTGGG + Intergenic
1122960807 14:105092948-105092970 TGCCAGGGTCTGGTGGGGGGGGG + Intergenic
1123166253 14:106327852-106327874 TATCATGGTTTGGTGGGGAGCGG - Intergenic
1123168942 14:106352886-106352908 TATCATGGTTTGGTGGGGAGTGG - Intergenic
1202894382 14_KI270722v1_random:190089-190111 TACCAAGGGCTGAGAGGGAAGGG - Intergenic
1123449466 15:20350937-20350959 TCCCCAGGGCTGGTGGAGGGGGG - Intergenic
1123459087 15:20452095-20452117 TACCAGGGGCTGGAGAGCAGGGG + Intergenic
1123658974 15:22548323-22548345 TACCAGGGGCTGGAGAGCAGGGG - Intergenic
1123960857 15:25398461-25398483 TACCAGGGGCTGGGGGTGAGTGG - Intronic
1124036803 15:26060873-26060895 TCCCTAGAGCAGGTGGGGAGTGG + Intergenic
1124265325 15:28227939-28227961 TACCAGGGGCTGGAGGGCAGAGG + Intronic
1124312839 15:28642815-28642837 TACCAGGGGCTGGAGAGCAGGGG - Intergenic
1126044321 15:44624510-44624532 TACCAAGGACTGTGGGGTAGGGG + Intronic
1126365915 15:47894379-47894401 AACCAGGGCCTGTTGGGGAGTGG + Intergenic
1126462226 15:48926404-48926426 TGTCAGGAGCTGGTGGGGAGGGG + Intronic
1127405278 15:58638115-58638137 TTCTAAGAGCTGCTGGGGAGGGG - Intronic
1128007197 15:64254212-64254234 TGCCAAGGGGTTGGGGGGAGGGG + Intronic
1128425639 15:67539692-67539714 TGCCAGGGGCTGGAGGGAAGGGG + Intergenic
1128703538 15:69821743-69821765 CACCTAGGACTGGTGGGGAAGGG + Intergenic
1128766591 15:70254831-70254853 AGCCAAGGGCTGCAGGGGAGGGG - Intergenic
1128851954 15:70968143-70968165 TACCAGGGCCTGTTGGGGTGTGG - Intronic
1129074419 15:72979840-72979862 TACCAAGTACTGATGGGGATAGG + Intergenic
1129162733 15:73755763-73755785 TGCCAGGGGCTGGCGGGGGGAGG - Intergenic
1129467930 15:75734267-75734289 CAGCCAGGGCTGGTGGGGAGTGG - Intergenic
1129995420 15:80000761-80000783 TACCAAGTGTTGGTGAGGAGTGG + Intergenic
1130353092 15:83108074-83108096 GCCCAGGGGCCGGTGGGGAGCGG + Intronic
1130570599 15:85039919-85039941 TACCAGAGGCTGGAGGGTAGGGG + Intronic
1131077114 15:89502340-89502362 TACCAAGGGCAGTTGAGGAAGGG - Intergenic
1131077255 15:89503159-89503181 TACCAAGCTGGGGTGGGGAGAGG - Intergenic
1131525427 15:93148641-93148663 TACCAGGGGCTGGAGGGGCAGGG - Intergenic
1132152116 15:99469522-99469544 AACCAAGGGTTGGGGGGCAGGGG - Intergenic
1132467072 16:82277-82299 TATCACGGGCTGGGGAGGAGGGG - Intronic
1132557470 16:578954-578976 TCCCAGGGGGCGGTGGGGAGGGG - Intronic
1132654483 16:1036176-1036198 CACCAAGGCCTGGCGGGAAGAGG + Intergenic
1132682258 16:1147528-1147550 TGCCAAGGGCTGGGGGAGGGGGG - Intergenic
1132871101 16:2116110-2116132 TACCATGACCTGGTGGGCAGGGG + Exonic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1133136660 16:3717198-3717220 TCCCATGGGCGGGTGGCGAGGGG + Intronic
1133172263 16:3988535-3988557 TTTCCAGGGCAGGTGGGGAGGGG + Intronic
1133194170 16:4156896-4156918 TACCAGGGCCTGTTGGGGGGTGG + Intergenic
1133199463 16:4194319-4194341 AACCAGGGGCTGGGGGGAAGGGG - Intronic
1134109177 16:11503980-11504002 TGCCAAGGGCAGCTGGGGAAAGG - Intronic
1134320135 16:13155407-13155429 GTCCCAGGGCAGGTGGGGAGGGG - Intronic
1134381287 16:13729058-13729080 TGCCAAGGGCTGGTTTGGGGTGG - Intergenic
1134521433 16:14920784-14920806 TACCATGACCTGGTGGGCAGGGG - Intronic
1134709104 16:16319435-16319457 TACCATGACCTGGTGGGCAGGGG - Intergenic
1134716313 16:16359464-16359486 TACCATGACCTGGTGGGCAGGGG - Intergenic
1134950501 16:18349210-18349232 TACCATGACCTGGTGGGCAGGGG + Intergenic
1134958437 16:18392695-18392717 TACCATGACCTGGTGGGCAGGGG + Intergenic
1137267115 16:46878183-46878205 TACCAAGGGCTGGGGGGAGGCGG - Intergenic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1137421150 16:48335200-48335222 TATCAAGGGCTTGGGGGAAGAGG + Intronic
1137605292 16:49783131-49783153 TCCAAAGGGCTTGTGGGAAGAGG + Intronic
1137764284 16:50966014-50966036 TAATAGGGACTGGTGGGGAGTGG - Intergenic
1137773309 16:51035824-51035846 TCTAAAGGGCTGGTGGGGATTGG - Intergenic
1138372352 16:56537344-56537366 TACCAAGGGCTGGGGAGAGGAGG + Intergenic
1139588300 16:67918474-67918496 TGACAAGGGCTGGTGGGAGGTGG + Intronic
1139599163 16:67976286-67976308 TGACTAGGGCTGGTGGGCAGCGG - Intronic
1139977496 16:70825709-70825731 TACCAAGGGCTGGAGAGGATGGG - Intronic
1140074680 16:71686593-71686615 TGCCAGGGCATGGTGGGGAGGGG - Intronic
1140321628 16:73958057-73958079 TGTCATGGGGTGGTGGGGAGAGG + Intergenic
1141048514 16:80739232-80739254 TACCAAGGACTGGGGGAGAAGGG + Intronic
1141273593 16:82563754-82563776 TACCAGGGGCTGGGGGTGAGGGG - Intergenic
1141594549 16:85089365-85089387 TACAAAGGTCTGGTGGGGAAGGG - Exonic
1141896838 16:86963740-86963762 TACAAAGGGCACGTGGGTAGAGG - Intergenic
1141904016 16:87010962-87010984 GACCAGGAGCTGCTGGGGAGAGG + Intergenic
1142558206 17:793892-793914 TCCCAAAGGCTGGTGCAGAGAGG + Intergenic
1142598069 17:1039253-1039275 TTCCCAGGGGTGGAGGGGAGCGG + Intronic
1143899437 17:10162826-10162848 TACCAGGGGCTGGCGGGGAGAGG + Intronic
1144311917 17:14021782-14021804 TACCAGGGGCTGGGAGGCAGGGG - Intergenic
1144332842 17:14239537-14239559 TACCAGGGGCTGGGAGGCAGGGG + Intergenic
1144725393 17:17499382-17499404 TGCCTGGGGCTGGTGGGGGGGGG - Intergenic
1144782498 17:17815061-17815083 TCCCACAGGCTGGTGGGGAGAGG + Intronic
1145084900 17:19929193-19929215 TGCCTAGGGCTGGTGGAGTGGGG + Intronic
1145797608 17:27664907-27664929 TGCCCAGGGCTGGATGGGAGGGG - Intergenic
1145811348 17:27765934-27765956 CTCCAAGGGCTGCTGGGAAGGGG - Intronic
1145893769 17:28439053-28439075 TGCCAAGGGCTGTGGGAGAGGGG - Intergenic
1145935438 17:28712111-28712133 TCCCAAGGGTCGGTGGGGCGGGG - Intergenic
1146266512 17:31456843-31456865 TGCCTGGGGGTGGTGGGGAGGGG + Intronic
1146501736 17:33370487-33370509 AAGCAAAGGCTGGAGGGGAGGGG + Intronic
1146927731 17:36756580-36756602 TACCAGGAGCTGGGGGGGGGAGG - Intergenic
1147513155 17:41089858-41089880 TATCAGGGGCTGTTGGGGGGTGG + Intronic
1147515224 17:41109862-41109884 TATCAGGGGCTGTTGGGGGGTGG + Intergenic
1147965753 17:44193467-44193489 GACCCAGGGCTGGTGAGGAGTGG - Exonic
1148457004 17:47816528-47816550 TGGGAGGGGCTGGTGGGGAGCGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148777258 17:50102570-50102592 TGCTAGGGGCAGGTGGGGAGAGG - Intronic
1148997142 17:51720745-51720767 TACCAGAGGTTGGTGGAGAGAGG + Intronic
1149371329 17:55996038-55996060 TACCAGGGCCTGTCGGGGAGTGG - Intergenic
1149746665 17:59106095-59106117 TCGCAAGGACTGGTGGCGAGTGG + Intronic
1149844443 17:59996764-59996786 TGCCAAGGGCTGGGGTCGAGAGG + Intergenic
1150284151 17:63946083-63946105 TGACTAGGGCTGGTGGGGATGGG - Intronic
1151130611 17:71893098-71893120 TTCCATTGGCTGGTGGGGGGTGG + Intergenic
1151641433 17:75398306-75398328 TAGCAAAGGCTGGAGGGCAGTGG + Intronic
1152311214 17:79551236-79551258 AACCAGGGGCTGGGGGAGAGGGG - Intergenic
1152546628 17:81003624-81003646 CACCAGGGGCTGGTGGGGTTCGG - Intronic
1152612703 17:81323435-81323457 TTCCCAGGGCAGGTGGGGAGGGG - Intronic
1152871427 17:82755621-82755643 TATTAAGGGATTGTGGGGAGTGG - Intronic
1153505814 18:5796637-5796659 TGCCATGGGTTGGTGGGGGGTGG + Intergenic
1153724104 18:7937490-7937512 TGCCAAGGGCGAGTTGGGAGAGG - Intronic
1154043630 18:10883758-10883780 TACCAAGGGCTGAGGTGGGGAGG - Intronic
1155238264 18:23842972-23842994 AAGCAGGGGCTGGTGGAGAGGGG - Intronic
1155570499 18:27186722-27186744 TACCAAGTGCTAGAGGGGAGAGG - Intergenic
1156316262 18:35971994-35972016 TGCCAAGGCCTGGGAGGGAGAGG + Intergenic
1156580684 18:38371318-38371340 TGACAAGGGGTAGTGGGGAGGGG - Intergenic
1156930563 18:42637610-42637632 CACCAAGGCCTGTTGTGGAGTGG + Intergenic
1157200162 18:45653220-45653242 TTCCAAGGAGTGGTGGGGAATGG - Intronic
1157324217 18:46657389-46657411 GAGAGAGGGCTGGTGGGGAGGGG - Intergenic
1157444062 18:47731643-47731665 TAACAGGGGAAGGTGGGGAGGGG - Intergenic
1158435443 18:57432469-57432491 AATCAAATGCTGGTGGGGAGGGG + Intergenic
1158585947 18:58735063-58735085 TACCAGAGGCTGGGGGGGGGTGG - Intronic
1158830508 18:61272388-61272410 TTCCATTGGCCGGTGGGGAGTGG + Intergenic
1158854092 18:61525078-61525100 TGCCAGGGGCTGGGTGGGAGGGG + Intronic
1158952250 18:62505298-62505320 AACAGAGGGCTGGAGGGGAGGGG - Intergenic
1158953529 18:62519693-62519715 GACCCAGGGCTGTTGGAGAGGGG - Intergenic
1159126886 18:64234510-64234532 TCCCATGGGCTTGAGGGGAGAGG - Intergenic
1159315491 18:66767865-66767887 TACCAGGGGCTTGTGGAGGGAGG + Intergenic
1159600758 18:70426661-70426683 TACCCAGAGCTGGTGGGCAAAGG - Intergenic
1159617736 18:70600762-70600784 TACCAGGGGCTGGGGGAGAAGGG - Intergenic
1159843833 18:73434237-73434259 TACCCAGTGGTGGTGGGGAGGGG - Intergenic
1160394024 18:78559024-78559046 TTCCAGGGGCTGGGGAGGAGGGG - Intergenic
1160538831 18:79609757-79609779 TACCCTGGGCTGGGGGGGAAGGG - Intergenic
1160994095 19:1873777-1873799 GAGCAGGGGGTGGTGGGGAGAGG + Intergenic
1161636109 19:5390237-5390259 CCGTAAGGGCTGGTGGGGAGGGG + Intergenic
1162851234 19:13432510-13432532 TACCAGGGGCTGGTGGTGGAGGG + Intronic
1163099476 19:15085692-15085714 TACCAGGGGCTGGGGGCGGGAGG - Intergenic
1163113280 19:15174392-15174414 TACACCGGGCTGGTGGGGAAGGG + Exonic
1163687148 19:18718157-18718179 TGCCAGGGGCTGGGGAGGAGAGG - Intronic
1164430522 19:28184581-28184603 TAGCAGGGTGTGGTGGGGAGTGG - Intergenic
1164855505 19:31517686-31517708 TGCCGTGGTCTGGTGGGGAGGGG - Intergenic
1165958698 19:39517395-39517417 TCCCATGGGCTGGTGTGGAGGGG + Intronic
1166145507 19:40832045-40832067 TACCAAGGACGGGTGGGGGAAGG - Intronic
1166611101 19:44197468-44197490 TACCAGGGGCTGGAGTGGAGGGG + Intergenic
1166856228 19:45783829-45783851 TAGCAAGGGCAGCTGGGGTGGGG + Exonic
1166941211 19:46367153-46367175 TCCCAAGGGCCGGATGGGAGTGG - Intronic
1166994966 19:46715955-46715977 CTCAAAGGGATGGTGGGGAGAGG + Intronic
1168544876 19:57241885-57241907 GACCAAGGGCAGGTGAGAAGGGG - Intronic
925079581 2:1053474-1053496 TGCAAAGGGCTGGGGGGGTGGGG - Intronic
925253202 2:2459947-2459969 TGCCAAGGGCTGGTGAGGGGAGG + Intergenic
925309078 2:2869265-2869287 TGCCAAGGGCTGGGGTGGAGGGG + Intergenic
926929853 2:18026433-18026455 TACCAGAGGCTGGAGGGGAAGGG - Intronic
927144468 2:20153494-20153516 TACAAAGATCTGTTGGGGAGGGG + Intergenic
927255069 2:21034064-21034086 TACCAGCAGCTTGTGGGGAGGGG + Intronic
927767480 2:25825449-25825471 TGCCAGGAGCTGGTGGGCAGGGG - Intronic
927799710 2:26086952-26086974 TTCCAGGGACTGGAGGGGAGGGG + Intronic
927838981 2:26425086-26425108 TACCAAGGTCTAGGGGGAAGTGG - Intronic
928845341 2:35665126-35665148 TGCCTAGGCCTGGTGGTGAGAGG - Intergenic
928882165 2:36108935-36108957 CACCAAGGCCTGTTGTGGAGGGG + Intergenic
928891417 2:36207916-36207938 TACCAAGGGTTGGGGGTTAGGGG - Intergenic
929180433 2:39032284-39032306 TACCAGAGGCTGGAGGGTAGGGG - Intronic
929189788 2:39129057-39129079 TCCCAGGGCCTGGTGGGGAGGGG - Intergenic
929435009 2:41922118-41922140 TACCAAGGGCTGGTGACAAAGGG + Intergenic
929818767 2:45257192-45257214 TACCAAGGCACTGTGGGGAGAGG + Intergenic
930226034 2:48794262-48794284 TGCCAGGGACTGGTGGGGAAGGG - Intergenic
931166303 2:59752638-59752660 TACCAGAGGTTGTTGGGGAGGGG + Intergenic
931236854 2:60419303-60419325 TAGCTTGGGCTGGTGAGGAGGGG - Intergenic
931850335 2:66245608-66245630 TAGCTTGGGCTGGTGAGGAGGGG - Intergenic
931858231 2:66326604-66326626 TACCAGGGGCTGGTGGGGTGAGG + Intergenic
932073058 2:68640027-68640049 TACCAAGGGATGAGGGGGAGGGG - Intergenic
932266925 2:70375841-70375863 TACCAAGGGCTGGAGGTTGGGGG - Intergenic
932328701 2:70883686-70883708 TACCTAGGGCTGGCAGGGATGGG + Intergenic
932541980 2:72664725-72664747 TTCAAAGGGCTGCTGGGCAGGGG - Intronic
932611036 2:73200422-73200444 TACCAAGGGCTGGCTGGGCACGG - Intergenic
932682255 2:73836389-73836411 CACCACGGGGTGGAGGGGAGGGG - Intronic
932854634 2:75220377-75220399 TACCAGGGGCTAGGGGGAAGAGG - Intergenic
933696687 2:85223943-85223965 CACCAGGGCCTGTTGGGGAGTGG - Intronic
933737850 2:85509638-85509660 TACCAAGGGCTGGGGGGAGTGGG + Intergenic
934073180 2:88404510-88404532 TACCAAGTGCTGGTGAGATGTGG + Intergenic
934100820 2:88651446-88651468 TACCATGGAAAGGTGGGGAGAGG - Intergenic
934188728 2:89766751-89766773 GACCATGGGGTGGTGGGCAGGGG - Intergenic
934520805 2:95019026-95019048 AACCAGAGGCTGGTGGGCAGAGG - Intergenic
935027074 2:99287093-99287115 TGCCAGGGGCTGATGGGGAGAGG + Intronic
935184720 2:100721824-100721846 GCCTCAGGGCTGGTGGGGAGTGG - Intergenic
935294348 2:101635860-101635882 TTCCATGAACTGGTGGGGAGGGG - Intergenic
935525573 2:104162724-104162746 TATCAAGTACTGCTGGGGAGAGG - Intergenic
935574207 2:104692108-104692130 TGCCAGGAGCTGGAGGGGAGAGG + Intergenic
935742659 2:106164244-106164266 TAACATGGGCTGTGGGGGAGGGG - Intronic
935802580 2:106713731-106713753 TACTAGGGGTTGGTGGGGAGAGG + Intergenic
935988818 2:108700629-108700651 TACCAGGGGCTTGTGGAGTGGGG + Intergenic
936482171 2:112893845-112893867 TCCTACTGGCTGGTGGGGAGTGG + Intergenic
936498897 2:113050431-113050453 TGCCAGGGGCCGCTGGGGAGAGG + Intronic
937138549 2:119577174-119577196 TCACATGGGGTGGTGGGGAGGGG + Intronic
937311469 2:120905836-120905858 TACCAGGGGCTGATTGGGGGAGG + Intronic
937505430 2:122531419-122531441 TGCCTAGGGCAGGAGGGGAGTGG + Intergenic
938383448 2:130849097-130849119 TCCCAAGGGAGGGTGGGAAGAGG - Intronic
938554800 2:132415317-132415339 TACCAAGGCCTGGGAGGGAGAGG - Intergenic
938848817 2:135239231-135239253 TACCAGAGGCTGGAGGGGAAGGG + Intronic
939391674 2:141576434-141576456 CACCAGGGCCTGTTGGGGAGCGG + Intronic
939760311 2:146168183-146168205 TACCAAGAGCTTGAGGGAAGGGG - Intergenic
940443201 2:153744320-153744342 TACCAAATGCTGGTGAGGAGTGG - Intergenic
940768651 2:157817364-157817386 TGCCAAGGGCTAGTGGGGATGGG + Intronic
941062857 2:160867788-160867810 TACCAAATGCTGATGGGGATTGG + Intergenic
941651990 2:168101945-168101967 TGCCTAGGGCTGGTGGGTAGGGG - Intronic
941799716 2:169645037-169645059 TACCAGGGGCTGTGGGGAAGGGG - Intergenic
942063977 2:172252924-172252946 TACCAGGGGCTGGGGGAGAGGGG + Intergenic
942183931 2:173406527-173406549 TACCAAGGGGTGGGGTGGGGTGG - Intergenic
942468306 2:176232157-176232179 GAGTAAGCGCTGGTGGGGAGGGG - Intergenic
942477305 2:176341112-176341134 TTCCATGGGATGGTGGGGAACGG + Intergenic
942659288 2:178247007-178247029 TAACATGGGGGGGTGGGGAGGGG - Intronic
943423069 2:187694259-187694281 TACCAAGGGCTGGCGTGGGTAGG - Intergenic
943600870 2:189919547-189919569 CACCACGGTCTGTTGGGGAGTGG - Intronic
943644715 2:190397830-190397852 TGCCAAGGGCTTGGGGGAAGAGG + Intergenic
944938262 2:204592776-204592798 TGTCAAGGGCTGGTGGGAATAGG - Intronic
945578980 2:211569060-211569082 TACCAAGGATTGGAAGGGAGTGG - Intronic
946032271 2:216714627-216714649 TACCCAGGGCTGGGGGGCTGGGG - Intergenic
946135185 2:217640248-217640270 TACCAGGGGCCGGTGGTGAGGGG + Intronic
947118852 2:226797364-226797386 CACCGCGGGCTGGTGGGGTGTGG + Exonic
947595607 2:231409766-231409788 TACCAAGGGCTGCTGGGAGCAGG + Intergenic
947928635 2:233943266-233943288 CACCAGGGTCTGTTGGGGAGTGG - Intronic
948336398 2:237210799-237210821 CACGAAGGGCTGGAGGGGAAGGG + Intergenic
948505616 2:238425532-238425554 TGCCAAGGGCTGGGGGAGTGGGG - Intergenic
948898869 2:240946040-240946062 GACCTAGGGGAGGTGGGGAGGGG - Intronic
1168953110 20:1815946-1815968 TTCCTAGGGGTAGTGGGGAGAGG + Intergenic
1168953215 20:1816897-1816919 GCCTAAGGGCTGATGGGGAGGGG - Intergenic
1169678713 20:8184947-8184969 CACCAGGGCCTGTTGGGGAGTGG - Intronic
1169794624 20:9448407-9448429 TACCAAGGGCTGTTTGGGCCAGG - Intronic
1169809907 20:9599027-9599049 TACCAGGGGCTGGAGGGAAGGGG - Intronic
1169975304 20:11319091-11319113 TGCCAGGGGCTGGGTGGGAGAGG - Intergenic
1170789791 20:19498316-19498338 TTCCATGGACTGGTGGGGAAGGG - Intronic
1171049963 20:21848533-21848555 TACTAGGGGCTGGTGGAAAGAGG + Intergenic
1172133466 20:32671885-32671907 TGCCAGGGGCTGAGGGGGAGTGG + Intergenic
1173449266 20:43148101-43148123 TACCCTGGGCTGGTTGGGTGGGG + Intronic
1173485110 20:43435329-43435351 TATCAGTGGGTGGTGGGGAGGGG + Intergenic
1173708377 20:45132276-45132298 TAGCAGGGGCTGGGGGGAAGGGG - Intergenic
1173757224 20:45527389-45527411 TGCCAGGGGCTGGTGGGAGGGGG - Intergenic
1174111858 20:48202670-48202692 GAGCACGGGCGGGTGGGGAGTGG - Intergenic
1174169281 20:48606152-48606174 GAGCACGGGCGGGTGGGGAGGGG + Intergenic
1174335246 20:49855048-49855070 TCCAAGGGGCTGGTGGCGAGGGG + Intronic
1174519434 20:51118357-51118379 GACCATGAGCTGGTGGGTAGGGG + Intergenic
1174773928 20:53326070-53326092 TACCAAGGTTGGGTGGGGCGCGG - Intronic
1174812613 20:53660078-53660100 GAACAAGGGGGGGTGGGGAGGGG + Intergenic
1175311537 20:58015076-58015098 TAACAGGGGCTGGTGGAGGGGGG + Intergenic
1175969757 20:62678887-62678909 TGCCAGGGGCTGGGGTGGAGAGG + Intronic
1176159321 20:63640547-63640569 TGCAAAGCCCTGGTGGGGAGGGG + Exonic
1177128551 21:17228034-17228056 TAGGAAGGGCAGGAGGGGAGTGG + Intergenic
1177414115 21:20772233-20772255 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1177668293 21:24190946-24190968 TACCAGGGCCTGGTGAGGGGAGG - Intergenic
1178148706 21:29769423-29769445 TTCCAAGGACTGGAGGTGAGGGG + Intronic
1178326564 21:31651113-31651135 TACCAAGTGTTGGTGAGGATGGG + Intergenic
1178477249 21:32947727-32947749 TGCCAGGTGCTGGTGGGAAGGGG - Intergenic
1178711511 21:34921301-34921323 TACCAGAGGCTGTGGGGGAGGGG - Intronic
1178935230 21:36856047-36856069 CACCCAGGGCTGGTGGGTGGGGG + Intronic
1179059975 21:37970931-37970953 TACCATGGGGTGATGGGGTGAGG - Intronic
1179199979 21:39207982-39208004 TTCCAAGGACTGGGGGTGAGGGG + Intronic
1179224528 21:39442236-39442258 TGCCAAGGCCTGGTGGGTGGAGG + Intronic
1179435670 21:41360562-41360584 TTCCCAGGGCTGCTGGTGAGGGG + Intergenic
1179478048 21:41660289-41660311 TTGCAATAGCTGGTGGGGAGTGG - Intergenic
1179838876 21:44057337-44057359 CACCAAGGGCTGGCGTGCAGTGG + Intronic
1179875924 21:44267370-44267392 CACCATGGGCTGGAGGGCAGAGG - Intergenic
1181778824 22:25178495-25178517 TGCAAAGCCCTGGTGGGGAGGGG + Intronic
1182428172 22:30285804-30285826 CACCAAGGGCTGGGGCAGAGGGG - Intronic
1182566895 22:31206770-31206792 TGCCGAGGGATGGTGGGAAGGGG - Exonic
1182673272 22:32016213-32016235 TCCCAACTGTTGGTGGGGAGTGG + Intergenic
1182679707 22:32069251-32069273 TACCAGGGTCTGGGGGTGAGCGG + Intronic
1182684686 22:32112718-32112740 TATCAAGGGCTGGGGGAGGGAGG + Exonic
1182750927 22:32641632-32641654 TGCCTAGGGCTGTTGGGGTGTGG + Intronic
1183116956 22:35699728-35699750 TATCACGGGCGGGTGGGGGGGGG - Intergenic
1183398747 22:37588687-37588709 TACCTGGGGATGGTGAGGAGAGG + Intergenic
1183451765 22:37899962-37899984 TACCAGGGGCTGGTGGGTAGGGG - Intergenic
1184056366 22:42052999-42053021 TGCCAAGGGATGGAGGGAAGAGG - Intronic
1184163950 22:42716548-42716570 AACCAAGGCCTGCTGGGCAGCGG + Intronic
1184322064 22:43749443-43749465 TTCCATGGGCCAGTGGGGAGGGG + Intronic
1185236112 22:49714265-49714287 TATCAAGGGCTGGTGGGAATCGG + Intergenic
949188411 3:1221033-1221055 TACCTGGAGCTGGTGGGTAGGGG - Intronic
949192289 3:1264869-1264891 TACCAGAGGCTGGGGGAGAGGGG - Intronic
949563347 3:5222780-5222802 TCCCCAGGGCTGGAGGGGCGAGG + Intergenic
950024974 3:9813953-9813975 TACCAAGGGCAGCGGGGAAGGGG - Intronic
950032310 3:9861225-9861247 AAACAAGGTCTGGTGGGGGGTGG - Intergenic
950521429 3:13500188-13500210 TCCCAGGGGCTGCAGGGGAGGGG + Intronic
950703709 3:14767244-14767266 TAGCATGGGGTGGTGGGGAGAGG + Intronic
951988844 3:28652837-28652859 TATCAAGGGCTGGTGGGTGGGGG - Intergenic
953044298 3:39281318-39281340 TATCAAGGGGTGGTGTGGGGTGG - Intronic
953752800 3:45622205-45622227 TACCCAGGGCTGGAGGACAGCGG - Intronic
953932551 3:47012927-47012949 TGACAAGGGCTGGCGGGGACTGG + Intergenic
954252717 3:49380557-49380579 TACCCAGGCGTGGTGGGGTGAGG + Intronic
954625795 3:52021278-52021300 TCCTAATGGCTGGTGGGGACTGG + Intergenic
954738909 3:52730865-52730887 TGCCAGGGGCTGGTGGGGGCAGG + Intronic
954800280 3:53183272-53183294 TCCCCAGGGAGGGTGGGGAGAGG - Intronic
955154983 3:56408099-56408121 TCACAAGGGCTGGTGGGGTGAGG - Intronic
955964279 3:64371936-64371958 TGCCTAGGGCTGTGGGGGAGAGG + Intronic
956662078 3:71608869-71608891 TACCAAAGGCTGGGGGTGAGGGG + Intergenic
957021365 3:75131719-75131741 TACCAAGGACTGTGGGGTAGGGG + Intergenic
957556031 3:81765593-81765615 TTCCTAGGGCTGGAGGGCAGGGG + Intergenic
958529388 3:95307273-95307295 TGCCAAGGGCTGGAGGATAGGGG - Intergenic
958897575 3:99846155-99846177 TCCCAAGTGCTGGTGGGGGACGG - Intronic
959041560 3:101427852-101427874 CACCAGGGCCTGTTGGGGAGTGG - Intronic
959769941 3:110081754-110081776 TACCAAGAGCTGGGGCAGAGGGG + Intergenic
960065924 3:113372564-113372586 CACCAGGGCCTGTTGGGGAGTGG + Intronic
960155606 3:114294698-114294720 TGCCCAGGGTTGCTGGGGAGAGG + Intronic
960221748 3:115120010-115120032 TGCCAGGGGCTGGGGGAGAGAGG + Intronic
960690593 3:120342278-120342300 GACCATGGGCAGGCGGGGAGAGG - Intronic
960902092 3:122563812-122563834 TGTCAAGGGCTGGTGAGGGGAGG - Intronic
961003250 3:123388231-123388253 TAACCAGGGCAGGTTGGGAGGGG + Intronic
961026762 3:123565088-123565110 TACCAGGTGCTGTTGGGCAGTGG - Intronic
961225353 3:125239909-125239931 GACCCAGGGCTGGAAGGGAGTGG + Intronic
961385324 3:126520096-126520118 TTCCCTGGGCAGGTGGGGAGGGG - Intergenic
961422074 3:126814489-126814511 AACCTTAGGCTGGTGGGGAGTGG - Intronic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
962128013 3:132643221-132643243 TACAAAGAGCTGGGGGTGAGAGG + Intronic
962135703 3:132729846-132729868 TACCAGAGGCTGGTGGTGAGGGG - Intergenic
962206982 3:133442809-133442831 GATCAAGGGGTGGTGGGGAAAGG + Intronic
963066548 3:141268979-141269001 TACCTAGGGGTGGTGTGGACGGG - Intronic
963482922 3:145899620-145899642 TACCAAGGGCTGGTGGAAAGGGG - Intergenic
963491354 3:146005320-146005342 TATCAAGGGCTGGTGGCATGAGG + Intergenic
964600629 3:158497211-158497233 TGCCAGGGGCTAGGGGGGAGGGG - Intronic
964707178 3:159631655-159631677 TACCAGGGGCTGGAGGGAATGGG + Intronic
965544884 3:169905009-169905031 TACCAGGGCCTGGTGGGGAGAGG + Intergenic
966047841 3:175574519-175574541 TTCAAAGGGCTGGTGAGGGGTGG + Intronic
966594934 3:181717384-181717406 TTCCCTGGGCTGGTGGGGGGTGG + Intergenic
967724771 3:192851335-192851357 TGCCAAGGGCTGTTGGGGAGTGG + Intronic
967769254 3:193315958-193315980 TACCAAGGGCTAGGGGGAGGGGG - Intronic
967936539 3:194732661-194732683 TTCCAAGGTCTGTTTGGGAGAGG + Intergenic
968737031 4:2303072-2303094 TCCCAGGGCCTGATGGGGAGTGG + Intronic
968863225 4:3189606-3189628 TGCCAGGGGCTGCAGGGGAGGGG + Intronic
970177107 4:13350506-13350528 TCCCATGGGCTGGAGGGGACAGG + Intergenic
970300100 4:14671968-14671990 TAGCAGGGGCTGGGGGGCAGGGG + Intergenic
971853571 4:32014698-32014720 TACCAGGGTCTGTTGGGGTGTGG + Intergenic
972065010 4:34931147-34931169 TACCAGGGGCTGGTAGATAGAGG + Intergenic
972893098 4:43584185-43584207 TTCCAAAGGCTGGGGGTGAGAGG + Intergenic
973774081 4:54229928-54229950 GACCAGGGGGAGGTGGGGAGAGG + Intronic
974138549 4:57851515-57851537 TACCAAGGGCTTGATGGGAATGG + Intergenic
975519239 4:75280841-75280863 TACCAAGGCCTGTTGGGGGCTGG + Intergenic
975666192 4:76737572-76737594 TACCAAATGCTGGTGAGGATGGG - Intronic
976269478 4:83216926-83216948 TAACAGGGGCTGGGGGAGAGGGG + Intergenic
976510375 4:85901981-85902003 TACCAAGGCCTGTTGGGGGGTGG - Intronic
978204647 4:106066684-106066706 TACCACGGGCTGGGGGAGGGAGG - Intronic
978870342 4:113568234-113568256 TACCAGGTGCTGGAGGAGAGGGG - Intronic
979558266 4:122075634-122075656 TGCCGAGGGATGGTGGGAAGGGG + Intergenic
980912389 4:139005550-139005572 TAACAAGTGCTGGTGAGCAGGGG + Intergenic
981594952 4:146409448-146409470 TGCCAAGGGCTGGGAGGGAGGGG + Intronic
981697786 4:147575954-147575976 TCCCAAGATCTTGTGGGGAGAGG - Intergenic
982093730 4:151901520-151901542 TACCAGAGGCTGGGGGAGAGGGG - Intergenic
982111090 4:152055489-152055511 TACCAGGGGCTGGGGAGGTGGGG - Intergenic
982494354 4:156071625-156071647 TACCACGGGCTGGAGAGAAGGGG + Intergenic
984783586 4:183548107-183548129 TACCAGGGGCTGGAGGTAAGGGG - Intergenic
985231014 4:187817670-187817692 TACCAAGGGTTGGGGGAAAGGGG - Intergenic
985513019 5:322479-322501 TGGCAAGGGCAGGCGGGGAGGGG + Intronic
985640784 5:1062664-1062686 TACCCAGGGCTGGGGGGCTGGGG + Intronic
985771013 5:1810809-1810831 TACCAGGGGCTGGGGGGCCGGGG - Intronic
985995235 5:3594046-3594068 CGCCGAGGGTTGGTGGGGAGTGG - Intergenic
986432818 5:7698543-7698565 TACCAGGGCCTGTTGGGGAGGGG - Intronic
986619515 5:9657724-9657746 CAGCAGGGGCTGGCGGGGAGTGG + Intronic
986624549 5:9711496-9711518 TGCCAGGGGCTGGTGGGAGGTGG + Intronic
987498217 5:18672892-18672914 TAGCTTGGGCTGGTGAGGAGGGG + Intergenic
987909622 5:24124451-24124473 TACCAGGGACTGGTGGTGAGTGG - Intronic
988193237 5:27965895-27965917 TACTGAGAGATGGTGGGGAGGGG - Intergenic
988366640 5:30309349-30309371 GACCAAGAGCTGGGGGGGAGTGG - Intergenic
988731350 5:33976176-33976198 TACCAAGTGCTGATAGGGAAGGG + Intronic
989560860 5:42849249-42849271 TACCATGAGCTAGTGGGAAGGGG + Intronic
990398771 5:55414687-55414709 TACCAAGGCCTGGAGTGCAGTGG + Intronic
990549339 5:56857911-56857933 TACCAAGTGCTGGTATGGAAAGG - Intronic
991927283 5:71718339-71718361 TACCAAGGGTTGGTGGTGGGTGG + Intergenic
992663000 5:78980078-78980100 TTCCAAGGGCTGGTGGAATGAGG + Intronic
993038853 5:82788967-82788989 TGCCAAGGGCTGGTGGGGGAAGG + Intergenic
993119700 5:83759455-83759477 CACCAGGGGCTGCTGGGGGGTGG + Intergenic
993221217 5:85099866-85099888 AAGCAAGGGGTGGTAGGGAGAGG + Intergenic
993489492 5:88529073-88529095 TAGCAAGTGTTGGTGAGGAGTGG - Intergenic
993554903 5:89324236-89324258 TACCAGAGGCTTGTTGGGAGAGG - Intergenic
994204830 5:97023070-97023092 TACCAGGGGCTGGTGGGGAGAGG - Intronic
996076039 5:119195562-119195584 TTTCAAGGGCTGGTGGTGGGGGG + Intronic
996106671 5:119512808-119512830 TGCCAAGGGCTGGAGGAGAAAGG + Intronic
996356911 5:122605500-122605522 TACCAAGGGCTGGGTGGGGATGG - Intergenic
996884698 5:128341472-128341494 TACCAATAGCTGACGGGGAGGGG - Intronic
997197160 5:131987884-131987906 TTGCAAGGGCTGGTGGTGAGTGG - Intronic
997543980 5:134689972-134689994 TACCAGGGGCTGGGGGGGGAGGG + Intronic
997895678 5:137714605-137714627 TGCCTAGGGCTGATGGGGAGTGG + Intronic
999287294 5:150401831-150401853 GGCCAAAGGCTGGAGGGGAGAGG + Intronic
999618956 5:153453744-153453766 TAGCTTGGGCTGGTGAGGAGGGG + Intergenic
1000937202 5:167317002-167317024 GACCAAGGGATGATGAGGAGAGG - Intronic
1001334462 5:170785813-170785835 AGCCAAGGGCTGGTGGGAAGAGG + Intronic
1001621908 5:173093920-173093942 TGCCAGGGGCTGGTGGGTGGGGG - Intronic
1002451630 5:179322267-179322289 GACCCAGCGCAGGTGGGGAGAGG + Intronic
1002806012 6:574869-574891 TACCAACTACTGTTGGGGAGAGG - Intronic
1003129656 6:3385066-3385088 TACCAAGGGCTGGGGAGAGGAGG + Intronic
1004001010 6:11597343-11597365 TACCAGGGGCTGGGGGGCAGGGG - Intergenic
1004699428 6:18065321-18065343 TCCCAAGGGCTGGGTGGGGGAGG - Intergenic
1004735122 6:18398147-18398169 TACCAGGGGCTGGTGGGAGGGGG - Intronic
1004793115 6:19051030-19051052 TGGGAAGGGCTGGTGGGCAGGGG - Intergenic
1004878004 6:19975366-19975388 TGCAGAGGGCTAGTGGGGAGGGG - Intergenic
1004943857 6:20590513-20590535 CACCGGGGGCTGTTGGGGAGTGG - Intronic
1005378827 6:25213181-25213203 CACCAAGGCCTGTTGGGGGGTGG + Intergenic
1005903381 6:30239118-30239140 TGCCAGGGACTGGTGGGGACGGG - Intergenic
1006576093 6:35047547-35047569 CACCCAGGCATGGTGGGGAGGGG - Intronic
1007272158 6:40646168-40646190 GAGCAGGGGGTGGTGGGGAGAGG - Intergenic
1007825277 6:44595322-44595344 AATCAAGGGCTGGAGAGGAGGGG + Intergenic
1008218572 6:48825944-48825966 TACCTAAGGCTGGTGGGAAATGG + Intergenic
1008224479 6:48897347-48897369 TACCAAGAGCTGGAGGAGCGAGG - Intergenic
1008537741 6:52519978-52520000 TACCAAGGGCTGGGAGTGAGAGG + Intronic
1008631727 6:53368339-53368361 TACCAGGGGCTGGAGGGAGGAGG + Intergenic
1009398159 6:63226840-63226862 TACAAGGGGCAGGTGGGAAGCGG + Intergenic
1009659743 6:66595619-66595641 TACCAAGGCCTGTCGGGGGGTGG - Intergenic
1010064266 6:71662844-71662866 GACCAAAAGCTGGTGGGGAAGGG + Intergenic
1010257785 6:73779082-73779104 TCCCAAGGGCTGTGGGGAAGGGG - Intronic
1010271044 6:73916311-73916333 TACCAGGGCCTGTTGGGGGGTGG - Intergenic
1010582868 6:77620938-77620960 TGCCAGGGGCTAGTGGGAAGGGG - Intergenic
1010632214 6:78211413-78211435 TGCCAAGGGCTGGAGGGGAGAGG - Intergenic
1010888473 6:81273377-81273399 TACCAGGGGCTGGAGGGTGGAGG + Intergenic
1010908669 6:81525116-81525138 TACCAAGGACTGTCGGTGAGTGG + Intronic
1011291270 6:85779735-85779757 AACCATGGGGTGGTGGGGGGCGG - Intergenic
1011903641 6:92333677-92333699 TATCAAGGGCTGGGGGAGGGAGG - Intergenic
1012150449 6:95743761-95743783 TAGCAATGGGGGGTGGGGAGGGG + Intergenic
1012389968 6:98727308-98727330 AGCCATGGGATGGTGGGGAGAGG - Intergenic
1012487085 6:99734390-99734412 CACCAGGGGCTGTTGGGGGGTGG - Intergenic
1012498512 6:99862359-99862381 TACAAAGGGTTTGTGGGGTGAGG + Intergenic
1012973009 6:105751721-105751743 TACCAGAGGATAGTGGGGAGGGG - Intergenic
1013014822 6:106151417-106151439 TACCAAGGGATGGTGGAATGGGG - Intergenic
1013020874 6:106216560-106216582 TGCCAAGGGCTGGAGGGAGGGGG + Intronic
1014727174 6:124985158-124985180 TACCAAGTGCTGGTTAGGATAGG + Intronic
1014792996 6:125695817-125695839 TACCAAAGGCTGGGGTGGGGAGG + Intergenic
1015918490 6:138242796-138242818 TCTCAAGAGCTGGTGGGTAGGGG + Intronic
1016473107 6:144396359-144396381 TACCAGGGGCTGGTGGGTATGGG + Intronic
1016508159 6:144808671-144808693 TACCAGGGGCTGGGGGGTGGAGG - Intronic
1016706913 6:147119469-147119491 TGCCAGGGGCTGGAGGGAAGAGG + Intergenic
1017550582 6:155502561-155502583 TACCAAGTGTTGGTGAGGACAGG - Intergenic
1017716944 6:157219271-157219293 CACCAAGAGCTCGTGTGGAGAGG + Intergenic
1018757471 6:166862685-166862707 AACCAAGGGCTGGGGAGGCGGGG + Intronic
1018808815 6:167282380-167282402 CACCAAGGTCTGTGGGGGAGGGG + Intronic
1020458864 7:8405530-8405552 TACCAGGGCCTGTCGGGGAGTGG - Intergenic
1021473057 7:21028525-21028547 TCCCAAGGGCTGGAGGGAGGTGG + Intergenic
1021527303 7:21603064-21603086 TGCCAAGGATTGGTGGGTAGGGG - Intronic
1021942519 7:25692351-25692373 TGCCAAGGGCTGAGGGGCAGAGG + Intergenic
1021989857 7:26130761-26130783 AAGCAGGGGCTCGTGGGGAGTGG - Intergenic
1022235284 7:28454847-28454869 GACCCAGGGCTGGTGGGCAGTGG + Intronic
1022290817 7:29000848-29000870 TGCCAGGGGCTGATGGGGAGAGG - Intronic
1022299146 7:29086250-29086272 TGCCAAGGGCTGGAGTGCAGTGG - Intronic
1022380011 7:29851032-29851054 TGCCAAGGACTGGGGGAGAGGGG - Intronic
1023255509 7:38308650-38308672 TACCAATGTCTGCTGGAGAGGGG + Intergenic
1023589751 7:41768896-41768918 TGCCAAAGGCTGGGGGGCAGGGG - Intergenic
1023615095 7:42011743-42011765 TTTCAGGGGCTGGCGGGGAGGGG + Intronic
1023643946 7:42289720-42289742 TACCATGAGCTGGTGGGGTTTGG - Intergenic
1023729941 7:43181485-43181507 AAACAAGTGCTGGTGGGGTGTGG - Intronic
1024034420 7:45495348-45495370 TACCAAGTTCCCGTGGGGAGGGG - Intergenic
1024111903 7:46155472-46155494 AACCAGGGGCTGGAGGGCAGGGG - Intergenic
1024313540 7:47992010-47992032 CACCATGAGCTGCTGGGGAGAGG - Intronic
1025607257 7:63048198-63048220 CACCAAAGAATGGTGGGGAGGGG - Intergenic
1025619963 7:63159713-63159735 TACCAGGGGCTGGGGGTGGGTGG - Intergenic
1025715022 7:63947581-63947603 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1026086324 7:67266087-67266109 TGCCAAGGGCTGGTGGGGGAGGG - Intergenic
1026265668 7:68794038-68794060 TGCCAAGGGATGGAGGGAAGGGG + Intergenic
1026491101 7:70864301-70864323 TGCCAAGGGCTGGAGTGGGGAGG - Intergenic
1026690820 7:72548742-72548764 TGCCAAGGGCTGGTGGGGGAGGG + Intergenic
1027642246 7:80750724-80750746 TTCTAAGGGCTGGAGGGAAGAGG + Intronic
1028180840 7:87722355-87722377 TACCAGAGGCTGGGGGGTAGGGG - Intronic
1028949077 7:96613703-96613725 TACCAGAGGCTGGGTGGGAGTGG - Intronic
1029170149 7:98624758-98624780 TATCAGTGGCTGGTGTGGAGCGG + Intronic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029440189 7:100583075-100583097 TCCCAAGGGCTGGGAGGGAAGGG + Intronic
1029896739 7:103990724-103990746 AGCCAAGGGTGGGTGGGGAGAGG - Intergenic
1030029403 7:105354901-105354923 TACCTAGAGCTGGTGGGGAGGGG - Intronic
1031196481 7:118620907-118620929 CACCAGGGCCTGTTGGGGAGTGG - Intergenic
1031282045 7:119817225-119817247 TAACAAGTGCTGGTGAGGATGGG - Intergenic
1031325440 7:120391073-120391095 TACCAGGGCCTGTTGGGCAGTGG - Intronic
1032026942 7:128450638-128450660 TGCCAAGGGCTGGAGGAGAGGGG - Intergenic
1032061531 7:128729296-128729318 TACCACCTGCTGGTGGTGAGTGG - Intronic
1032215569 7:129954588-129954610 TATCAAGGGCTGGGGGGGAAGGG - Intergenic
1033139295 7:138810649-138810671 TGCCAGGGGTTTGTGGGGAGCGG + Intronic
1033317971 7:140314219-140314241 TACCAAGGGCTGGGGCAGGGAGG + Intronic
1034116029 7:148584616-148584638 TACCACGGGCTGGTGGAAGGGGG - Intergenic
1034182116 7:149147321-149147343 GCCCAAGAGCTGGGGGGGAGGGG + Intronic
1034420653 7:150988963-150988985 TGGCAAGGACGGGTGGGGAGCGG - Intergenic
1034522643 7:151632385-151632407 TACCAAGGCGCGGGGGGGAGCGG - Intronic
1034752341 7:153582503-153582525 TGTCAAGGACGGGTGGGGAGTGG + Intergenic
1035011793 7:155724697-155724719 TGCCAGGGGCCGGTAGGGAGAGG - Intronic
1035172155 7:157022792-157022814 GACCAGGGGCTGCTGGGGGGAGG - Intergenic
1035565787 8:640025-640047 TCCCAAGCCCTGATGGGGAGTGG + Intronic
1036028588 8:4939627-4939649 TAACAAGGGCTGGGGGTGAGTGG + Intronic
1036656300 8:10679550-10679572 TACCCAGGGCTGGAGGGCACAGG - Intronic
1036777676 8:11624828-11624850 CACCAAAGAATGGTGGGGAGGGG + Intergenic
1036790575 8:11715872-11715894 TACCAGGGGCTGGTGTGGAGAGG - Intronic
1036824694 8:11967035-11967057 GACCATGGGCTGGTTGTGAGTGG - Intergenic
1037048567 8:14340945-14340967 TACCAGGGGCTGGGGGAGAGGGG - Intronic
1037329303 8:17728130-17728152 TGCCAGGGGCTGGTGGGGAAGGG + Intronic
1037426505 8:18761278-18761300 TAAAAAGGGATGGTGGGTAGAGG + Intronic
1037437026 8:18873732-18873754 TACCAGGGACTGGTGGGTGGTGG - Intronic
1038160454 8:25032135-25032157 TATGGAGGGCTGGTGGGGTGAGG - Intergenic
1038878070 8:31574142-31574164 TTCCAGGGGCTGGAGGGAAGGGG + Intergenic
1039023281 8:33230563-33230585 TTCCCAGGGCTGGTAAGGAGGGG - Intergenic
1039293307 8:36122095-36122117 TACCAGGGCCTGTTGGGGGGTGG - Intergenic
1039624126 8:39030260-39030282 TGCCAAGGGTTGGAGGGGTGGGG - Intronic
1040098521 8:43474665-43474687 TACCTAGAGCTGGAGTGGAGGGG + Intergenic
1040707484 8:50146689-50146711 TATCAATGGCTGGTGAGGATCGG - Intronic
1041206298 8:55501461-55501483 TGCCAGGGGCTGGAGGTGAGGGG - Intronic
1041363317 8:57074239-57074261 CACCAGGGCCTGTTGGGGAGTGG - Intergenic
1041517073 8:58712163-58712185 TGCCTAGGGCTGGTGGGGAGAGG + Intergenic
1041747075 8:61219304-61219326 TACCAAGGCCTGTTGGTGGGGGG - Intronic
1041763795 8:61395285-61395307 TACCAGAGGCTGGGGGAGAGGGG + Intronic
1041900088 8:62972831-62972853 CACCAGGGCCTGTTGGGGAGTGG - Intronic
1042264470 8:66893902-66893924 TGCCAAGTTCTTGTGGGGAGAGG - Intronic
1042304654 8:67318395-67318417 AACCAAGAGCTGGTTGGGTGAGG + Intronic
1042576874 8:70230305-70230327 TGCCAAGGGCTGGAGGGAAGGGG + Intronic
1043294051 8:78642409-78642431 TACCAAAGGCTGAGGGGCAGGGG - Intergenic
1043633239 8:82363448-82363470 CACCAGGGCCTGTTGGGGAGTGG - Intergenic
1043762437 8:84084569-84084591 TGTCAGGGGCTGCTGGGGAGAGG + Intergenic
1044126453 8:88464114-88464136 TACCAGGGCCTGTTGGGGAGTGG - Intergenic
1044237488 8:89848073-89848095 TACCAGAGGCTGGGGTGGAGTGG + Intergenic
1044606199 8:94050195-94050217 CACCAGGGACTGTTGGGGAGGGG - Intergenic
1044636013 8:94324859-94324881 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1044941544 8:97348921-97348943 TTCCAAGGGCTGGGGAGGTGGGG - Intergenic
1045397965 8:101780550-101780572 TGGCAGGGGCTGATGGGGAGGGG + Intronic
1045712390 8:105000146-105000168 CACCAGGGCCTGTTGGGGAGTGG + Intronic
1047300671 8:123611226-123611248 CACCAGGGCCTGCTGGGGAGTGG - Intergenic
1047566836 8:126053716-126053738 TGCCAGGGGCTGCAGGGGAGGGG + Intergenic
1048160430 8:132015889-132015911 TGCCAAGGCCTGGTGGGGAAGGG - Intergenic
1048389731 8:133950945-133950967 TAACAAGTGTTGGTGGGGATAGG + Intergenic
1048489292 8:134877607-134877629 TGCCAGGGGCTGGAGGGGAGAGG + Intergenic
1049001048 8:139825898-139825920 TGCCAGGCTCTGGTGGGGAGAGG + Intronic
1049689942 8:143953969-143953991 AACCACAGGCTGGGGGGGAGGGG - Intronic
1051058775 9:13021220-13021242 TACCAGAGGCTGGTGGGGGGGGG + Intergenic
1051453404 9:17223715-17223737 TATCAATGGCTGGTGGGTTGAGG - Intronic
1053122501 9:35557449-35557471 AACCAAGGGCTTGAGAGGAGGGG + Intronic
1053294491 9:36903024-36903046 TGCCAAGTGCTGGTGGTGAGGGG - Intronic
1053396303 9:37777464-37777486 TACTAAGGTCTTGCGGGGAGAGG - Intronic
1053438307 9:38092429-38092451 TACCAGGGGCTGGAGGGAGGAGG - Intergenic
1053585838 9:39457712-39457734 TACCAGAGGCTGGGGGTGAGGGG + Intergenic
1054580468 9:66907510-66907532 TACCAGAGGCTGGGGGTGAGGGG - Intronic
1055002293 9:71465619-71465641 TCCCCAGGGCTGATGGGGAATGG + Intergenic
1055051536 9:71986452-71986474 TACCAAGCGATGGTGGGCTGGGG - Intergenic
1055177478 9:73337478-73337500 TACCAGGGCCTGTTGGGGGGTGG + Intergenic
1055440941 9:76335296-76335318 TCCCCAGGGCTGGTGGGGGGAGG + Intronic
1055972237 9:81923081-81923103 TGTCAGGGGCTAGTGGGGAGGGG + Intergenic
1055973990 9:81938153-81938175 TGTCAGGGGCTAGTGGGGAGGGG + Intergenic
1056222703 9:84465865-84465887 AGCCTAGGGCTGGTGGGGCGGGG + Intergenic
1056485867 9:87057069-87057091 TACCAGGGGCTAGGGTGGAGGGG + Intergenic
1056526814 9:87450838-87450860 CACCAAGGGCTGTTGGGGAGTGG - Intergenic
1057295338 9:93831713-93831735 TACTAGGGGCTAGAGGGGAGGGG - Intergenic
1057709041 9:97420447-97420469 TGCCAAGGGCTGGGGGTAAGGGG - Intronic
1058360775 9:104143724-104143746 TGCCAAGGGCTGGGGAGCAGGGG - Intergenic
1058526829 9:105867389-105867411 CACCCAGGGCTGTTGGGGTGGGG - Intergenic
1058669848 9:107351589-107351611 TAACAAGGGGTGATGGGGAGAGG + Intergenic
1058736732 9:107900544-107900566 TGCCAAGGGGTGGTGGGCTGAGG + Intergenic
1059134674 9:111794210-111794232 TGCCTTAGGCTGGTGGGGAGAGG - Intronic
1059275485 9:113093165-113093187 TACTAATGGCTGGTGGGAGGTGG + Intergenic
1060466656 9:123912847-123912869 CACCACGGGGTGGAGGGGAGTGG - Intronic
1060777689 9:126388201-126388223 TGCCTAGGGCTGGCGGGGAGTGG - Intronic
1061002449 9:127910114-127910136 TACCAAGTGCTGCTGGGGCCTGG - Intronic
1061448161 9:130653590-130653612 TGCCAGGGGCTGGTGGTGGGGGG - Intergenic
1061513580 9:131075782-131075804 TACCAAGGGCTCGCAGGGAAGGG - Intronic
1061553015 9:131348941-131348963 GAGCAAGGGCTGTGGGGGAGAGG - Intergenic
1061598985 9:131653625-131653647 TACCAAGTGTTGGTGAGGACTGG + Intronic
1062023390 9:134329569-134329591 TAGGAAGGGCTGGTGGGGGGCGG + Intronic
1062239375 9:135527436-135527458 CAATGAGGGCTGGTGGGGAGCGG + Intergenic
1062483819 9:136764494-136764516 CACCAGGGGCTGGAGGGCAGGGG - Exonic
1203491396 Un_GL000224v1:108754-108776 TACCAAGGGCTGAGGGGGAAGGG - Intergenic
1203504020 Un_KI270741v1:50624-50646 TACCAAGGGCTGAGGGGGAAGGG - Intergenic
1186431468 X:9508920-9508942 CACCAGGGCCTGTTGGGGAGTGG + Intronic
1186917304 X:14237298-14237320 TGCCAGAGGCTGGTGGGAAGGGG + Intergenic
1186974192 X:14882324-14882346 TACCAGGGGCTGGAGGGGTGAGG + Intronic
1186998864 X:15154482-15154504 TGCCTAGGGCTGGTGGGGAATGG + Intergenic
1187176086 X:16897599-16897621 TGCCAAGTGTTAGTGGGGAGTGG + Intergenic
1187246217 X:17555006-17555028 CACCAGGGCCTGTTGGGGAGTGG - Intronic
1187478735 X:19635404-19635426 TACCAGGGCCTGTTGGGGGGTGG + Intronic
1187494817 X:19785909-19785931 TGCCAGGGGCTGGGGGGAAGGGG + Intronic
1187597990 X:20796169-20796191 TACCAGGGACTGTTGGGGGGTGG - Intergenic
1187627733 X:21134869-21134891 TACCAGGGCCTGTTGGGGGGTGG + Intergenic
1187720766 X:22148642-22148664 TACCAAAGGCTGGAGGGAGGGGG - Intronic
1187875493 X:23800344-23800366 TACCAGGGCGTGGTGGGGGGGGG + Intergenic
1187988328 X:24839578-24839600 GAGCCATGGCTGGTGGGGAGGGG + Intronic
1188656282 X:32700397-32700419 TACCAGGGGCTGTGGGGCAGGGG + Intronic
1189493854 X:41492074-41492096 TACCAGGGGCTGGGCAGGAGGGG + Intergenic
1189862192 X:45284522-45284544 TTCCAGGGGCTGGGGGGAAGAGG - Intergenic
1189884352 X:45525649-45525671 TAATGAGGGATGGTGGGGAGTGG + Intergenic
1190037394 X:47038468-47038490 TAACAAATGCTGGTGAGGAGTGG - Intronic
1190428748 X:50357455-50357477 TACCTAGGGCTCATGGGGTGTGG - Intergenic
1190754454 X:53389688-53389710 TATCACGGGCTGGTGTGCAGGGG - Intronic
1190968836 X:55329503-55329525 TAGCAAATGCAGGTGGGGAGGGG - Intergenic
1191147691 X:57185714-57185736 CACCAAGGCCTGTTGGGGGGTGG - Intergenic
1192272517 X:69595543-69595565 TACCAGAGGCTGGTGGTGGGAGG + Intergenic
1192405934 X:70886422-70886444 TTCCAAGGGCTGGGGGAAAGGGG + Intronic
1192428988 X:71100148-71100170 TACCTGGGGCTGGTGGGCACTGG - Intronic
1192510912 X:71719831-71719853 TACTAAGGGCTGGGGGAGACAGG + Intergenic
1192515785 X:71761722-71761744 TACTAAGGGCTGGGGGAGACAGG - Intergenic
1192693997 X:73395172-73395194 CACCAGGGCCTGTTGGGGAGTGG + Intergenic
1192783421 X:74316417-74316439 TTGCAAGAGATGGTGGGGAGTGG + Intergenic
1193056142 X:77153275-77153297 TACCAGGGCCTGTTGGGGGGTGG + Intergenic
1193368245 X:80660464-80660486 TGCCAAGAGCTGGGGTGGAGGGG - Intergenic
1193743782 X:85249869-85249891 TGCCTAGGGCTGGTGGGGAGAGG - Intronic
1194206548 X:91018131-91018153 TATTAAGGGTTGGTGGGGGGGGG - Intergenic
1194284584 X:91994311-91994333 TACCAAGGGCTGGGAGGGTGAGG - Intronic
1194491801 X:94560270-94560292 TAACAATGGCTGGTGAGGATGGG - Intergenic
1194855836 X:98927446-98927468 TACCAGGGCCTGTTGGGGGGTGG + Intergenic
1194989013 X:100524919-100524941 TACCAGGGGCTGGAAGGGTGAGG - Intergenic
1195374330 X:104211865-104211887 AACCAAGAGTTGGTGGGGGGTGG - Intergenic
1195643295 X:107201359-107201381 TACCAGGGGCTGGAGGAGGGAGG - Intronic
1195750286 X:108157297-108157319 TGCCAAGGGTTGGTGTGGGGAGG + Intronic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1197245806 X:124165281-124165303 TGCCAAGGGCTTTAGGGGAGGGG - Intronic
1197431049 X:126364200-126364222 CATCAAGGGCTGTTGGGGGGTGG + Intergenic
1197963556 X:132032046-132032068 TAGTGAGGGGTGGTGGGGAGAGG - Intergenic
1198092654 X:133346864-133346886 TGCCCAGGGCTGGGGGAGAGGGG + Intronic
1198139681 X:133790298-133790320 TTCCAAGGGGTGGGTGGGAGGGG - Intronic
1198155556 X:133956740-133956762 TACCTAGAGCTGGTGGGAATAGG - Intronic
1198406541 X:136318361-136318383 TGCCAGGGGCTGGAGGGGAGGGG + Intronic
1198446551 X:136723129-136723151 TGCCAAGGGCTGGAGGGAATGGG + Intronic
1198568044 X:137925366-137925388 TACCAAGGCCTAGGGGTGAGTGG + Intergenic
1198590490 X:138175000-138175022 TACCAAAGGCTATTGGGGTGAGG - Intergenic
1199210265 X:145200202-145200224 TACCAAGGACTGGAGGAGAGGGG + Intergenic
1199567502 X:149230649-149230671 AACCAGGAGCTGGTGGGGCGGGG - Intergenic
1199734229 X:150669036-150669058 CACCAGGGCCTGTTGGGGAGTGG - Intronic
1199809869 X:151338707-151338729 TAAAAAGAGTTGGTGGGGAGAGG + Intergenic
1199861482 X:151804252-151804274 TACCAGAGGCTGGTGGAGGGTGG - Intergenic
1200064654 X:153498632-153498654 CACCAAGGCCAGGAGGGGAGGGG - Intronic
1200096224 X:153664872-153664894 TGCCAAGCACTGGTGGGGGGGGG + Intergenic
1200111071 X:153741136-153741158 GACCATGGGGTGGTGGGCAGGGG + Intronic
1200299470 X:154958214-154958236 TAAGAAGAGCTGATGGGGAGAGG - Intronic
1200602150 Y:5218875-5218897 TACCAAGGGCTGGGAGGGTGAGG - Intronic
1201106536 Y:10767580-10767602 TACCAAGGAATGGAGTGGAGAGG - Intergenic
1201251472 Y:12062749-12062771 CACCAGGGCCTGTTGGGGAGTGG + Intergenic