ID: 1137408394

View in Genome Browser
Species Human (GRCh38)
Location 16:48207810-48207832
Sequence ATGGGGGGTTCAAATCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137408392_1137408394 -9 Left 1137408392 16:48207796-48207818 CCACAGGGGATGGAATGGGGGGT 0: 1
1: 0
2: 2
3: 26
4: 224
Right 1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1137408381_1137408394 18 Left 1137408381 16:48207769-48207791 CCACATGGCAGCAGACCTCAAAC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1137408380_1137408394 26 Left 1137408380 16:48207761-48207783 CCACACATCCACATGGCAGCAGA 0: 1
1: 0
2: 4
3: 35
4: 359
Right 1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1137408385_1137408394 3 Left 1137408385 16:48207784-48207806 CCTCAAACTCGTCCACAGGGGAT 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137408394 Original CRISPR ATGGGGGGTTCAAATCTCAA GGG Intronic