ID: 1137408832

View in Genome Browser
Species Human (GRCh38)
Location 16:48210941-48210963
Sequence AGGCTACCTTGGACACCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137408822_1137408832 26 Left 1137408822 16:48210892-48210914 CCTCAGGTCCTGAGAGCCTGGCA 0: 1
1: 0
2: 8
3: 26
4: 336
Right 1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1137408825_1137408832 10 Left 1137408825 16:48210908-48210930 CCTGGCAGCTGGCCTGCCTGCGT 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1137408827_1137408832 -2 Left 1137408827 16:48210920-48210942 CCTGCCTGCGTGGCCTGAACAAG 0: 1
1: 0
2: 0
3: 17
4: 310
Right 1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1137408824_1137408832 18 Left 1137408824 16:48210900-48210922 CCTGAGAGCCTGGCAGCTGGCCT 0: 1
1: 0
2: 4
3: 31
4: 337
Right 1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1137408829_1137408832 -6 Left 1137408829 16:48210924-48210946 CCTGCGTGGCCTGAACAAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 80
Right 1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137408832 Original CRISPR AGGCTACCTTGGACACCACC AGG Exonic
902190137 1:14756639-14756661 AGGCAGCCTCGGACACCACTAGG + Intronic
908512085 1:64857597-64857619 AGGCTACACTGGACACCTCATGG + Intronic
910364817 1:86453557-86453579 ACCCTATCTTGGACAGCACCTGG + Exonic
911472208 1:98332756-98332778 AGGAAACCATGCACACCACCTGG - Intergenic
912273623 1:108234188-108234210 AGTCTACCTGGGACACCAATTGG + Intronic
912294597 1:108460134-108460156 AGTCTACCTGGGACACCAATTGG - Intronic
915366250 1:155318317-155318339 AGGCTACCATGGGCACCCTCTGG - Intronic
918246115 1:182660904-182660926 TGCCTCCCTTGGACACCACTTGG + Intronic
918292753 1:183124656-183124678 TGGCTACTTTGGAGACCCCCTGG + Exonic
919650696 1:200146476-200146498 TGGGTACCATGGAAACCACCTGG + Intronic
922843927 1:228667994-228668016 AAGCTATCTTGGCAACCACCAGG - Intergenic
923816203 1:237381699-237381721 AGGATACTGTGGACAGCACCTGG + Intronic
1063800821 10:9575503-9575525 AGACTGCCTTGGACTCCAGCTGG + Intergenic
1064477521 10:15707010-15707032 TGTCTCCCTTGGATACCACCTGG + Intronic
1067010174 10:42703780-42703802 AGCCTACCCTGGAGGCCACCTGG - Intergenic
1067313585 10:45139856-45139878 AGCCTACCCTGGAGGCCACCTGG + Intergenic
1076674761 10:132142181-132142203 CGGCTTCCATGGGCACCACCAGG - Intronic
1076877103 10:133221295-133221317 CAACTACCTTGCACACCACCTGG + Intronic
1080682566 11:34490184-34490206 AGGGAACCTTGGAGACCATCTGG + Intronic
1083672457 11:64306843-64306865 AGGCAACCTTCAACCCCACCTGG - Intronic
1084149067 11:67279730-67279752 AGGTCACCTTGGACAGCCCCTGG + Intronic
1084966820 11:72749149-72749171 AGGCTGCCTCGGTCACCACCCGG + Intronic
1087317204 11:96616391-96616413 AGGCTATCTTGGTCACCTCAGGG - Intergenic
1093319347 12:17693601-17693623 AGACTATCTTGGACAACACAGGG + Intergenic
1097522857 12:60689985-60690007 AGGCTCCCTTACACACCCCCAGG - Intergenic
1101506496 12:105351732-105351754 AGGCTCCAGGGGACACCACCTGG - Intronic
1102440834 12:112962974-112962996 ACCCTACCTTGGACTCCTCCTGG - Intronic
1115335764 14:32243155-32243177 AACCTAACTTGTACACCACCAGG - Intergenic
1119460490 14:74798577-74798599 TGGCTCCCTTGAAGACCACCTGG - Exonic
1122451749 14:101814380-101814402 TGGTTACCTTCCACACCACCAGG - Intronic
1122790919 14:104183852-104183874 AGGCTACAAGAGACACCACCTGG - Intergenic
1125883570 15:43212662-43212684 AGACTCACTTGGACACCCCCGGG - Intronic
1126836111 15:52667073-52667095 AGGGAACCTTGGAAATCACCAGG + Intronic
1127089889 15:55456869-55456891 TGGCTTCCTTGGACTCCAGCTGG - Intronic
1129519487 15:76176811-76176833 AGGCCACCTTGGAGACTGCCTGG - Intronic
1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG + Exonic
1133859799 16:9583781-9583803 AGACTGCCTTGGCCACCACTTGG - Intergenic
1134326598 16:13213331-13213353 ATGCTAACTTTGACAACACCTGG - Intronic
1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG + Exonic
1138922975 16:61555756-61555778 AGACTCCCTTGCACACCCCCAGG + Intergenic
1141281028 16:82629586-82629608 AGGCTTGCCTGAACACCACCAGG - Intronic
1143310173 17:5981225-5981247 AGTGTAAGTTGGACACCACCTGG - Intronic
1145281482 17:21470576-21470598 AGGCCAGGTTGGAAACCACCTGG - Intergenic
1147238842 17:39077290-39077312 AGGCTTCCTGGGACACCGCCTGG + Intronic
1147269460 17:39257712-39257734 AGGCTGCCTTTGACAGCCCCTGG + Intergenic
1148493207 17:48036844-48036866 AGGTTACCTTGGCCAGCAGCCGG + Exonic
1148724007 17:49775720-49775742 AGGCTACTTTGTAGACTACCAGG - Intronic
1151655315 17:75493111-75493133 TGGCTACGTTGGCCAGCACCAGG + Intronic
1151823863 17:76512761-76512783 AGGTGACCTTGGAGACCACCGGG + Intergenic
1154093552 18:11388028-11388050 ATGGTACCTTGGACAACACAAGG + Intergenic
1157622936 18:49026617-49026639 TGGCTACCCTGGACAGAACCTGG - Intergenic
1158930994 18:62325170-62325192 AGGGGAGCTTGGGCACCACCTGG + Intergenic
1162407878 19:10486437-10486459 AGGCTGTCTTGGACACTCCCGGG + Exonic
1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG + Intronic
1164549944 19:29201498-29201520 AGCCTGCCATGGACATCACCTGG + Intergenic
1165927383 19:39335501-39335523 GGTCTACCTCGCACACCACCAGG + Exonic
1168503101 19:56910022-56910044 ACCCTAACTTGTACACCACCAGG + Intergenic
925684830 2:6459455-6459477 AGCCTCCCTTGCACACCCCCAGG - Intergenic
926334074 2:11850161-11850183 AGGCTCCCTTCGGCAGCACCTGG + Intergenic
927179346 2:20433449-20433471 AGGCCAACTTGGAATCCACCCGG + Intergenic
927789316 2:25998008-25998030 AGGCTGACTTGGAGACCACTTGG + Intergenic
937088273 2:119186471-119186493 ATTCTCCCTTGGACACCAGCTGG + Intergenic
940373265 2:152924880-152924902 AGGCTGGCTGGCACACCACCTGG + Intergenic
945514841 2:210750441-210750463 AAGTTAACTTGGACACCTCCTGG - Intergenic
947066908 2:226237253-226237275 AGGCTACTATGGACTCCAGCCGG - Intergenic
948721770 2:239905249-239905271 GGGCTTCCTTGGCCACCACATGG + Intronic
1168794227 20:600605-600627 AGGCCACCTTGGACCCCAAAGGG - Intergenic
1171235426 20:23520517-23520539 AGGCTATCTGGGATCCCACCAGG + Intergenic
1174309166 20:49637080-49637102 AGGCTACTGTGGAGACCACAAGG + Intronic
1185132915 22:49050369-49050391 AGGCTGCCATGGTCTCCACCTGG + Intergenic
1185168267 22:49275683-49275705 AGGGAACATGGGACACCACCAGG - Intergenic
951139983 3:19148028-19148050 CTGCTCCCTTGGACACCACTGGG + Intergenic
952259156 3:31722774-31722796 AGGTTACCCTGGAAACCCCCAGG - Intronic
954410619 3:50369151-50369173 AGGCCACATTGGACACACCCAGG + Intronic
954611976 3:51949297-51949319 AGCCTACCTTGGTGACCACATGG - Intergenic
957149538 3:76468204-76468226 AGGCTACATTGGATAGCAACTGG + Intronic
965009066 3:163062926-163062948 AGCCTCCCTTGCACACCCCCAGG + Intergenic
968415949 4:433912-433934 ACCCTAACTTGCACACCACCAGG + Intronic
968764177 4:2459488-2459510 AGCCCACCTTGGCCACCCCCAGG - Intronic
975506332 4:75142792-75142814 AGGCTACCCCGGAAACCAACTGG + Intergenic
978271197 4:106892995-106893017 AGGCTTCCTCGCACACCTCCAGG + Intergenic
993306950 5:86285900-86285922 AGTCTACCTGGGACACCAATTGG - Intergenic
996082611 5:119272175-119272197 GGGGTATCTTGGAAACCACCTGG + Intronic
997088764 5:130831763-130831785 AGGCTGTCTTGGTCACCCCCAGG + Intergenic
1003949592 6:11105357-11105379 ACCCTAACTTGTACACCACCAGG - Exonic
1011168589 6:84479274-84479296 AGGCCAGCTTGCCCACCACCTGG + Intergenic
1011431501 6:87292043-87292065 ACACTACCTTGGAAACCACTGGG - Intronic
1017946742 6:159102223-159102245 AGGCTACCTTGAAAACAAACAGG - Intergenic
1024283723 7:47739417-47739439 AGCCTCCCTTGGGCATCACCTGG - Intronic
1024491590 7:49991799-49991821 AGGGTATCTAGGACACCACAAGG - Intronic
1028339836 7:89705094-89705116 TGGCTTCCATTGACACCACCTGG + Intergenic
1029028994 7:97448993-97449015 AGGCTATCTAGGAGACCAACAGG + Intergenic
1034908197 7:154969787-154969809 AGGCCAGCTAAGACACCACCGGG + Intronic
1045008372 8:97936080-97936102 AGGCCACCCTTGAGACCACCAGG + Intronic
1047960859 8:130010728-130010750 AAGCTAACTTGGAAACCTCCAGG + Intronic
1048164108 8:132046875-132046897 AGGCCAACTCAGACACCACCTGG - Intronic
1057870138 9:98710568-98710590 AGAGTACCTTGGACAGCGCCAGG + Intergenic
1058387711 9:104458521-104458543 ATGCTACCTTGTACATCACAAGG + Intergenic
1061563507 9:131421953-131421975 AGGCTGCACTGGACGCCACCAGG - Intronic
1062323976 9:136003833-136003855 TGGCTGCCTGGGACCCCACCAGG - Intergenic
1062341014 9:136094097-136094119 GGGCTGCCTTGGGCACCCCCGGG + Intronic
1187219916 X:17314397-17314419 AGTCTACCTTGAACAACACAGGG - Intergenic
1199599548 X:149533840-149533862 GGGCTACTTTGTAAACCACCAGG - Exonic
1199651083 X:149946367-149946389 GGGCTACTTTGTAAACCACCAGG + Intergenic