ID: 1137411720

View in Genome Browser
Species Human (GRCh38)
Location 16:48234125-48234147
Sequence TGGTGTAAACACACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 3, 2: 32, 3: 183, 4: 493}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137411716_1137411720 5 Left 1137411716 16:48234097-48234119 CCTGATATGTAGCCTTTGCCTAT 0: 1
1: 1
2: 10
3: 84
4: 366
Right 1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG 0: 1
1: 3
2: 32
3: 183
4: 493
1137411715_1137411720 6 Left 1137411715 16:48234096-48234118 CCCTGATATGTAGCCTTTGCCTA 0: 1
1: 1
2: 9
3: 76
4: 319
Right 1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG 0: 1
1: 3
2: 32
3: 183
4: 493
1137411714_1137411720 10 Left 1137411714 16:48234092-48234114 CCAGCCCTGATATGTAGCCTTTG 0: 1
1: 0
2: 1
3: 17
4: 122
Right 1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG 0: 1
1: 3
2: 32
3: 183
4: 493
1137411718_1137411720 -7 Left 1137411718 16:48234109-48234131 CCTTTGCCTATTTCTGTGGTGTA 0: 1
1: 5
2: 8
3: 32
4: 226
Right 1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG 0: 1
1: 3
2: 32
3: 183
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137411720 Original CRISPR TGGTGTAAACACACCCATCA TGG Intronic
900320764 1:2082581-2082603 TGGTGTAAATGCTCCCACCACGG + Intronic
900480351 1:2895179-2895201 TTGTGTAAGGACACCCCTCATGG + Intergenic
900837627 1:5017940-5017962 TGCTGAAAACCCTCCCATCATGG - Intergenic
901729967 1:11272575-11272597 TGGTGTAAATTCTCCCACCATGG + Intergenic
902125981 1:14211707-14211729 TGGTGTAAATATTCCCATCATGG - Intergenic
902544729 1:17183178-17183200 TGGTGTAAATACTCCCACCATGG + Intergenic
902757905 1:18561341-18561363 TGGTGTAAATGTTCCCATCAAGG - Intergenic
903264458 1:22149207-22149229 TGGTGTAAATATTCCCACCATGG - Intergenic
903735145 1:25525112-25525134 TGGTGTAAATACTCCCACCACGG + Intergenic
903736922 1:25535715-25535737 TGATGCAAATACACCCACCACGG - Intergenic
904621034 1:31775454-31775476 TGGTGTAAATCCTCCCATGATGG + Intergenic
904848799 1:33441317-33441339 TGGTGTAAGTACTCCTATCAAGG + Intergenic
904950295 1:34232612-34232634 TGGTATAAATACACCCACCTTGG + Intergenic
905187262 1:36205419-36205441 TGATGTAAACACTCCCACCATGG + Intergenic
905458622 1:38106065-38106087 TGGTGTAAATACTCCCACGATGG - Intergenic
905514525 1:38552399-38552421 TGGTGTAAATACTCCCACTATGG + Intergenic
905660779 1:39722502-39722524 TGGTGTAAATATTCCCACCATGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906112497 1:43333504-43333526 TGGTGTAAATACTTCCGTCATGG - Intergenic
906216738 1:44045567-44045589 GGGTGTAAATAGTCCCATCATGG - Intergenic
908034220 1:60034583-60034605 TGGTGTAAATACCCCCACCATGG + Intronic
908046506 1:60175676-60175698 TAGTGTAAACTTACCCATCATGG + Intergenic
908203288 1:61819671-61819693 TGGTGTAAATACTCCCACCATGG + Intronic
909119331 1:71581214-71581236 TGGTATAAACATTCCCACCATGG - Intronic
909781807 1:79557900-79557922 TGGTTTAAACGCTCCCTTCATGG - Intergenic
910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG + Intergenic
910496292 1:87832406-87832428 TGGTGTAAATACTCCCCACATGG + Intergenic
911267338 1:95757821-95757843 TGGTGTAAATACTGTCATCATGG + Intergenic
912242540 1:107926731-107926753 TGGTTTAAATACTCCCTTCATGG - Intronic
913536729 1:119780146-119780168 TGATGTAAACACTCTCATCACGG + Intergenic
915182429 1:154073957-154073979 TGGTGTTAATACTCCCATCATGG - Intronic
915289444 1:154873228-154873250 TGGTGTAAATACTCTGATCATGG - Intergenic
916618473 1:166470300-166470322 AGGTGTAAATACTCCCACCAAGG + Intergenic
916724766 1:167512933-167512955 TGTTGAAAACAATCCCATCAAGG - Intronic
917265601 1:173217567-173217589 TGGTATAAATACTCTCATCATGG - Intergenic
917742230 1:177971891-177971913 TGGTGTAAATACTCCCACCATGG - Intronic
917960117 1:180135739-180135761 TCGTGTAAATACTCCCACCATGG - Intergenic
918023431 1:180717774-180717796 TAGTGTAAATACTCCTATCATGG - Intronic
918164120 1:181928034-181928056 TGGTGTAAATACTCCCTCCATGG - Intergenic
920091622 1:203457080-203457102 TGATGTAAATATTCCCATCATGG + Intergenic
920443810 1:206000718-206000740 TGGTGTAAACACTTCCACCATGG + Intronic
920597195 1:207283933-207283955 TGGTTTCCACACAACCATCAGGG - Intergenic
920700246 1:208212600-208212622 TGGTATAAATACACCTATCCTGG - Intronic
921048525 1:211494158-211494180 AGGAGTCAACACACCCACCAAGG - Intergenic
921066402 1:211625618-211625640 TGGTGTAAATACTTCCACCACGG - Intergenic
921564730 1:216703008-216703030 TGGTGAATACAAACCAATCAAGG + Intronic
921584714 1:216933483-216933505 TGGTGTAAATACTCCCTCCATGG + Intronic
923258231 1:232240912-232240934 TGGTGTAAATACTCCCAGCAAGG - Intergenic
923442623 1:234035862-234035884 TGGTGGAAACAGACTCTTCAAGG - Intronic
923479624 1:234371512-234371534 TAGTGTAAACAGTCCCATCATGG + Intergenic
923479632 1:234371606-234371628 TAGTGTAAACAGTCCCATCGTGG + Intergenic
924167769 1:241303026-241303048 TGGTGTATACACTCCCTTCATGG - Intronic
924288655 1:242514179-242514201 GGGTGTAAAAACACCCACAATGG - Intronic
924721813 1:246630156-246630178 TGGTGTCAATACTCCCACCATGG - Intronic
1063305038 10:4890212-4890234 TAGTGTAAATACTCCCACCATGG + Intergenic
1063364897 10:5484345-5484367 TGGTGTAAATACTACCACCAGGG + Intergenic
1063549413 10:7015671-7015693 TGGTGTAAGTTCTCCCATCACGG + Intergenic
1063869075 10:10398854-10398876 TGGTGTAAATACTCCCACCATGG + Intergenic
1064150938 10:12864218-12864240 TGGTGCAAATATACTCATCATGG - Intergenic
1064729512 10:18315812-18315834 TGGTATAAATACTCCCACCATGG + Intronic
1064839542 10:19575295-19575317 TGGTGTAAATACTCCCAGCATGG + Intronic
1065825169 10:29564115-29564137 TGGTGTCAACACTCCCACCATGG + Intronic
1066038949 10:31525400-31525422 TGGCATAAATACTCCCATCATGG + Intronic
1066322193 10:34314627-34314649 TGGTGTAAACACTGCCACCATGG + Intronic
1066684754 10:37970083-37970105 TGGTATAAATACTCCCACCATGG - Intronic
1067186860 10:44036575-44036597 TGGTGTAAACATTCCCACCAGGG + Intergenic
1067795562 10:49318934-49318956 TGGTGAAGGCACTCCCATCAGGG - Intronic
1067970429 10:50963971-50963993 GTTTGTAAACACACCAATCAGGG + Intergenic
1067982473 10:51102034-51102056 TGGAGTAAATACCACCATCATGG + Intronic
1067986282 10:51149808-51149830 TGGTGTAAATACTCCCACCATGG - Intronic
1067988053 10:51174570-51174592 TGGTGTGAATATTCCCATCATGG + Intronic
1068004773 10:51380294-51380316 TGGTGTAAATACTCCCACTATGG - Intronic
1068523436 10:58102740-58102762 TGCTGTAAATACTCCCACCATGG + Intergenic
1068739259 10:60450356-60450378 TGATGTAAATACTCCCATCATGG + Intronic
1068776479 10:60873316-60873338 TGATATAAATACTCCCATCATGG - Intronic
1068782469 10:60935913-60935935 TGGTGTAAATATTCCCACCATGG - Intronic
1069624973 10:69862018-69862040 TGGTGTGAATACTCCCACCATGG + Intronic
1069786491 10:70991390-70991412 TGGTGTAAATGCTCCCACCACGG + Intergenic
1069898412 10:71693237-71693259 TGGTGTAAATAGCCCCACCAGGG - Intronic
1070248697 10:74754682-74754704 TGGTGTAAATACACCCACCATGG + Intergenic
1070277166 10:75018259-75018281 CAGTGTACCCACACCCATCAGGG + Intronic
1070325832 10:75388309-75388331 TGGTATAAATACTCCCACCATGG + Intergenic
1070766575 10:79060057-79060079 CGGTGTAAATACCCCCACCATGG - Intergenic
1070993477 10:80753905-80753927 TGGTATAAACACTCCCAGCATGG + Intergenic
1071245351 10:83755223-83755245 TGATGTAAACACCTCCATCCAGG - Intergenic
1071428266 10:85581393-85581415 TGGTGTAAATATTCCCATCATGG + Intergenic
1071832978 10:89390669-89390691 TGGGCTAAACAAACCCATGAGGG - Intronic
1073334879 10:102699142-102699164 TGTTGTACCCACACCCATCTTGG - Intronic
1073536697 10:104283040-104283062 TGGTGTAAACACTTCCGTCAAGG + Intronic
1074371478 10:112904061-112904083 TAGTGTAAATAGTCCCATCATGG - Intergenic
1074658655 10:115624637-115624659 TGTTGCAAACACTCTCATCATGG - Intronic
1074689853 10:115994507-115994529 TAGTGTAAATATTCCCATCATGG - Intergenic
1074935528 10:118176072-118176094 TGGTGTAAATACTCCCAGCATGG + Intergenic
1075266853 10:121007996-121008018 TGGTATAAATACTCCCATCATGG - Intergenic
1075417095 10:122272157-122272179 AGGTGGAAACTCAGCCATCAAGG + Intronic
1075533398 10:123249634-123249656 TGGTGTAAATACTTCCACCATGG + Intergenic
1075551883 10:123399079-123399101 TGGTGTAAATACTCCCACCATGG - Intergenic
1075573214 10:123559945-123559967 TGGTGTAAATACTTCCACCAGGG - Intergenic
1075590809 10:123689979-123690001 TGGTATAAACACTCCCACCGTGG - Exonic
1075766610 10:124898484-124898506 TGGTGTAAATATTCCCACCAGGG - Intergenic
1077208324 11:1354710-1354732 TGGTGTAAACATTCCCACCATGG - Intergenic
1078052849 11:7982703-7982725 TGGTGTAAATACTCCCACCATGG - Intronic
1078120610 11:8505025-8505047 TGGTATAAGCACACCCACCATGG - Intronic
1078623508 11:12931654-12931676 TGGTGTAAATATGCCCTTCATGG + Intronic
1078699194 11:13664989-13665011 TCTTATATACACACCCATCATGG - Intergenic
1078757245 11:14222803-14222825 TGGTGTAAATACTCTCACCAGGG + Intronic
1078861064 11:15246969-15246991 TGGTGTAAATACTCCCACTATGG - Exonic
1079110187 11:17601042-17601064 TGGCGTAAACACTCCCACCAGGG - Intronic
1079249658 11:18778058-18778080 TGGTGTAAATGCTCCCACCATGG + Intronic
1079345509 11:19648362-19648384 TGGTGTAAATATTCCCATCATGG - Intronic
1079611165 11:22434281-22434303 TGGTGTAAATACTCCCAACATGG + Intergenic
1080693756 11:34582957-34582979 TGGTGTAAATACTCCCATCATGG + Intergenic
1081485866 11:43528199-43528221 TGGTGTAAACACTCCCACCATGG - Intergenic
1081545951 11:44071668-44071690 TAGTGTAAATACTCCCACCATGG + Intronic
1082796037 11:57378442-57378464 TTGTGTAAATACTCCCACCATGG + Intronic
1082882947 11:58056171-58056193 TGGTGTAAATACTCCCACTATGG + Intronic
1084006817 11:66327345-66327367 TGGGGTCACCACACCCCTCATGG + Intergenic
1084580381 11:70019617-70019639 AGGTGTAAACCTTCCCATCATGG - Intergenic
1085180827 11:74534702-74534724 TGGTGTAAATACTCCTACCATGG - Intronic
1085516471 11:77114844-77114866 TGGTGTAAATACTCCCACCATGG + Intronic
1085700495 11:78741368-78741390 TGGTGTAAATACTCTCATCATGG + Intronic
1085770197 11:79318511-79318533 TGGTGTAAATACTCCAACCATGG + Intronic
1086029570 11:82337530-82337552 TGGTGCAAATATTCCCATCATGG + Intergenic
1086520266 11:87661160-87661182 TGGTGCAAATACTCCCACCATGG - Intergenic
1086647134 11:89236982-89237004 TGGTGTAAATACTCTCACCATGG - Intronic
1087135175 11:94709406-94709428 TGGTGTAAATACTCCCACCATGG + Intronic
1087533680 11:99416102-99416124 TGGTCTAAATACTCCCACCAAGG - Intronic
1088394766 11:109354445-109354467 TGGTGTAAATACACACACAATGG - Intergenic
1088405849 11:109477622-109477644 TGGTGTAAACACTCCCACCCTGG - Intergenic
1088901510 11:114121218-114121240 TGGTGTAGATACTCCCACCATGG + Intronic
1089105337 11:115998532-115998554 TAGTGTAAACATACCCAACATGG + Intergenic
1089114642 11:116084776-116084798 TGGTGTAAATACTCCTACCATGG - Intergenic
1089783800 11:120893734-120893756 TGGTGTAAACACACCCGCTATGG - Intronic
1090267707 11:125363906-125363928 TGGTGTAAATGCTCCCACCATGG + Intronic
1090851466 11:130574414-130574436 TGGTGTAAATACCCCCACCCTGG + Intergenic
1091292786 11:134451486-134451508 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292815 11:134451626-134451648 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292829 11:134451696-134451718 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292842 11:134451766-134451788 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292856 11:134451836-134451858 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292869 11:134451906-134451928 TGGTGTAAATACCCTCACCATGG + Intergenic
1091292883 11:134451976-134451998 TGGTGTAAATACCCTCACCATGG + Intergenic
1091677725 12:2503585-2503607 TGGTGTAAATACTTCCACCATGG + Intronic
1091971673 12:4792681-4792703 TGGTGTAAATGCTCCCACCATGG + Intronic
1091999479 12:5020528-5020550 TGGTGTAAATACTGCCACCAGGG - Intergenic
1092035678 12:5332656-5332678 TGGTGTAAATACTCCCACCGTGG + Intergenic
1093383817 12:18525667-18525689 TGGTGTAAATACTCCCATTATGG - Intronic
1093633098 12:21433351-21433373 TGGTGTAAATACTCCTATTACGG + Intergenic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1094044460 12:26152170-26152192 TGGTGTAAATACTCCCACCGTGG + Intronic
1094065043 12:26352915-26352937 TGGTGCAAATACTCCCACCAGGG - Intronic
1095404972 12:41857841-41857863 TAGTGTAAACACTTCCACCATGG + Intergenic
1097548104 12:61030349-61030371 TGGTGTTAAACCACTCATCAGGG - Intergenic
1097630142 12:62050817-62050839 TGGTGTAAATACTCCTACCATGG - Intronic
1097936301 12:65255927-65255949 AGGTGTAAATACTCCCAACATGG - Intergenic
1098019892 12:66143451-66143473 TGGTGTACATACATCCTTCATGG + Intronic
1098070563 12:66669715-66669737 TGGTGTAAATACTCCCACTATGG + Intronic
1098115753 12:67174847-67174869 TAATGTAAATACACGCATCAAGG - Intergenic
1098223086 12:68291119-68291141 TGGTGTAAATACTCCCACCATGG + Intronic
1098234652 12:68406827-68406849 TGGTGTAAATTCTCCCATTATGG - Intergenic
1098722281 12:73915773-73915795 TGGTATAAATACTCCCACCATGG + Intergenic
1099187926 12:79535989-79536011 TGGTGGAAATACTCCCACCATGG - Intergenic
1099657878 12:85518603-85518625 TGGTGTAAATATTCCCACCATGG - Intergenic
1099961841 12:89404293-89404315 TGGTGGAAACACACAGAACATGG - Intergenic
1100278591 12:93095606-93095628 TGGTGTAAACACTCCCACCATGG + Intergenic
1101184633 12:102262217-102262239 TGATGTAAATATTCCCATCATGG + Intergenic
1101322907 12:103688952-103688974 TGGCGTAAATACTCCCACCAGGG - Intronic
1101403236 12:104406359-104406381 TGGTGTAAATACTCCCATCATGG + Intergenic
1101585124 12:106079133-106079155 TGATGTAATCACACCCACCCCGG + Intronic
1101752961 12:107598231-107598253 TGGTGTAAATACCCCCAGTATGG + Intronic
1102178737 12:110895533-110895555 TGGTGGGACCACATCCATCATGG + Intronic
1102186778 12:110954796-110954818 TGGTGTAAATATTCCCACCATGG - Intergenic
1102209830 12:111118436-111118458 GGGTGTAAATATTCCCATCATGG - Intronic
1102228495 12:111246254-111246276 TGGTGTAAATACTCCCACCATGG - Intronic
1102626311 12:114238022-114238044 TGGTGTAAATAATCCCAGCATGG + Intergenic
1102750736 12:115291671-115291693 TGGTGGAAATACTCCCACCATGG - Intergenic
1102872040 12:116421405-116421427 TGGTGAAACTACACCCATCTTGG + Intergenic
1103236857 12:119380328-119380350 TGGTGTAAATATTCCCATCATGG - Intronic
1103252574 12:119513024-119513046 TGGTGTAGTCACAGTCATCAAGG + Intronic
1103873499 12:124108648-124108670 TGGTGTAAATGCACCTACCAAGG + Intronic
1104118149 12:125770312-125770334 TGGTGTAAATACACCCACAGTGG - Intergenic
1104613655 12:130250899-130250921 TGGTGTAAATACTCCCATCGTGG + Intergenic
1105718977 13:23095188-23095210 GGCTGTAAACCCACCCATGAGGG + Intergenic
1105781299 13:23706960-23706982 TGGTGTAAACACTCCCACTGTGG + Intergenic
1105806126 13:23952617-23952639 GTTTGTAAACACACCAATCAGGG - Intergenic
1105890365 13:24678264-24678286 TGGTGTAAAGATACACATCATGG - Intergenic
1106855693 13:33849424-33849446 TGGTGTAAACACTCTCACCATGG + Intronic
1107043226 13:35970517-35970539 TGCATTAAACACACCCATGAGGG - Intronic
1108123418 13:47214371-47214393 TGTTGTAAATACACCCATCATGG - Intergenic
1108842065 13:54630891-54630913 TGGTGTAAATATTCTCATCAAGG - Intergenic
1109053458 13:57514474-57514496 TGATGTAAATACTCTCATCATGG + Intergenic
1109283146 13:60380161-60380183 TGGTATAAATACTCCCTTCATGG - Intergenic
1110376630 13:74802082-74802104 TGGTTTAAACACTCCCTCCATGG - Intergenic
1111349348 13:87005822-87005844 TGGTGTAAATACACCCACCATGG + Intergenic
1111851512 13:93581933-93581955 TTATGTAAAAACACCCATCAGGG - Intronic
1112037462 13:95509987-95510009 TGGTGTAAATACTCCCAACTTGG + Intronic
1112108752 13:96271138-96271160 TGGTGTAAATACTCCCAGCATGG + Intronic
1112181031 13:97080916-97080938 TGGTGTAAATACTCCCACCATGG - Intergenic
1112184690 13:97116270-97116292 TGGTGTAAAAACTCCCACCATGG + Intergenic
1112955471 13:105052209-105052231 TTGTTTAAATACTCCCATCATGG - Intergenic
1113150329 13:107256350-107256372 TGGTGTAAATACTCCCGTTATGG - Intronic
1113190975 13:107745579-107745601 TGTTGTAAACACTCAAATCAAGG + Intronic
1115244446 14:31280817-31280839 TGGTGTTCACACAGCCATCCTGG + Intergenic
1115272528 14:31569754-31569776 TGGTTTAAATATTCCCATCATGG - Intronic
1115709489 14:36034673-36034695 TGGTGTAAACATAGCTATCCTGG + Intergenic
1115791815 14:36888030-36888052 TAGTGTAAATACTCCCACCATGG - Intronic
1116728929 14:48597542-48597564 TGGTGTAAATATTCCCACCACGG + Intergenic
1116784791 14:49275786-49275808 TGGTGTAAACACAATCATCTTGG - Intergenic
1116923550 14:50608422-50608444 TGGTGTAAATATACCCATCATGG - Intronic
1117006681 14:51427811-51427833 TGGTGTAGATACTCCCACCATGG - Intergenic
1117018556 14:51545528-51545550 TGGTGTAAATACTCCCACCCTGG - Intronic
1117074494 14:52088767-52088789 TGGTGTAAATATTCCCACCATGG - Intergenic
1117320499 14:54618292-54618314 TGGTGTAAATACTCCTAACATGG - Intronic
1117390175 14:55255257-55255279 TGGTGTAAATACTCCCATCATGG - Intergenic
1117445247 14:55798045-55798067 TGGTGTAAATACTCCCACCATGG + Intergenic
1117473018 14:56065641-56065663 TGGTGTAAATGCTCCCACCATGG + Intergenic
1117474241 14:56077844-56077866 TGGTGTAAATACCTCCACCATGG + Intergenic
1117667698 14:58074569-58074591 TGGTGTAAATCCTCCCACCATGG + Intronic
1118387012 14:65264448-65264470 TGGTGTAAATACTACCACCATGG - Intergenic
1119095548 14:71826980-71827002 TGGTGTAAATACCCCCACCATGG - Intergenic
1119651912 14:76389987-76390009 TGGTGTAAATACTCCCATCATGG - Intronic
1121018030 14:90560241-90560263 TGGTATAAACACTTCCACCATGG + Intronic
1121532706 14:94668770-94668792 TGGTGTAAATGCTCCCATCACGG + Intergenic
1121542736 14:94740860-94740882 TGGTGTAAACACTCTCTGCACGG - Intergenic
1121724797 14:96139443-96139465 TGGTGTAAATATTCCCACCATGG + Intergenic
1121910676 14:97789687-97789709 TGGTGTAAATACTCCCACCAGGG + Intergenic
1121915458 14:97833727-97833749 TGGTTTACACACACACCTCAGGG - Intergenic
1122052474 14:99069442-99069464 TGGTGTAAATACTTCCACCATGG - Intergenic
1122085886 14:99304375-99304397 TGTTGTAAATGCTCCCATCATGG + Intergenic
1122289764 14:100674207-100674229 TGGTGTAAATACTCCCACCATGG + Intergenic
1122440235 14:101726812-101726834 TGGTGTAAATACTCCCACCATGG - Intergenic
1122803261 14:104243391-104243413 TGGTGTAAACACTCCTGCCATGG + Intergenic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1124908652 15:33896573-33896595 TGGTCTAAGCACACCCACCACGG + Intronic
1125103115 15:35939014-35939036 TGGTGTAAATACTCCCACCACGG + Intergenic
1125114901 15:36079262-36079284 TGGTGTAAATTCTCCCAGCATGG + Intergenic
1125257887 15:37787866-37787888 TGGTGTAAATACTCTCACCATGG - Intergenic
1126539711 15:49808391-49808413 TGGTGTAAATACTCCCACCATGG - Intergenic
1126680769 15:51199922-51199944 TGGTGTAAATACTCCCACTATGG + Intergenic
1127412423 15:58722664-58722686 TGGTGTAAATACTCCCTTCATGG - Intronic
1127575620 15:60288819-60288841 TGGTGTAAATACTCCCATCATGG + Intergenic
1127731818 15:61808854-61808876 TGGCATAAATACTCCCATCATGG - Intergenic
1128710028 15:69864821-69864843 TGGTGTAAATAATCCCACCAGGG + Intergenic
1128746805 15:70120441-70120463 TGGTGTAAACACTCTCATGGTGG - Intergenic
1128880853 15:71241662-71241684 TGGTGTAAATACTTCCATCATGG - Intronic
1130069005 15:80630751-80630773 AGGTGTAAATATTCCCATCATGG - Intergenic
1130110504 15:80959920-80959942 TAGTGTAAATTCTCCCATCATGG + Intronic
1130185425 15:81677028-81677050 TGGTGTAAATACTTCCACCATGG + Intergenic
1130380543 15:83368458-83368480 TGGTGTAAATACTCCCACCATGG + Intergenic
1130440529 15:83948302-83948324 TGGTGTAAATACTCCCATCATGG - Intronic
1130626076 15:85516750-85516772 TGGTGTAAATACTCCCATAATGG + Intronic
1130834650 15:87637801-87637823 TGGTGTAAATACTCCCATGATGG + Intergenic
1130970727 15:88729902-88729924 TGGTGTAAATACTCCCATCATGG - Intergenic
1131315727 15:91335196-91335218 TGGTGTAAACACCCCAACCAGGG - Intergenic
1131426746 15:92351743-92351765 CGATGTAAACACTCTCATCATGG + Intergenic
1132001734 15:98187356-98187378 TGGTGTAAATATACCCTCCATGG - Intergenic
1132255407 15:100372824-100372846 TGATGTAATCACACCCTGCACGG - Intergenic
1132414207 15:101609191-101609213 TGGTGTAAATACTCCTATCATGG + Intergenic
1133624470 16:7557843-7557865 TGGTGCAAATACTCCCATCATGG + Intronic
1133679542 16:8108133-8108155 TGGTGTAAATATTCCCACCATGG - Intergenic
1133724405 16:8523914-8523936 TGGTGTAAATACTCCCACCACGG - Intergenic
1133799794 16:9075891-9075913 TGGTGTAAATACTCCCACCATGG + Intergenic
1134011573 16:10857431-10857453 TGGTGTAAATATTCCCACCATGG - Intergenic
1134109362 16:11505194-11505216 TGGTGTAAATATACCCACCATGG + Intronic
1134318800 16:13143867-13143889 TGGTGTAAATATCCCCACCATGG - Intronic
1134505960 16:14807095-14807117 TGGTGTAAATCCTCCCACCATGG - Intronic
1134574589 16:15321687-15321709 TGGTGTAAATCCTCCCACCATGG + Intergenic
1134727824 16:16434623-16434645 TGGTGTAAATCCTCCCACCATGG - Intergenic
1134879381 16:17731489-17731511 TGGTGTAAATACTCCCACCAGGG + Intergenic
1134939612 16:18277204-18277226 TGGTGTAAATCCTCCCACCATGG + Intergenic
1135292124 16:21248949-21248971 TGGTGTAAATACATCCACCATGG - Intronic
1135338713 16:21628295-21628317 TAGTGTAAATACTCCCATCATGG - Intronic
1135376795 16:21954076-21954098 TGGGGAAAACTCACACATCAGGG + Intronic
1136416319 16:30106329-30106351 TGGTTTAAATACTCCCATCTTGG - Intronic
1136448629 16:30339613-30339635 TGGTGTAAACACTTTCACCATGG - Intergenic
1136685423 16:31991365-31991387 TGGTGTAAATACTCCTACCATGG + Intergenic
1136786037 16:32934895-32934917 TGGTGTAAATACTCCTACCATGG + Intergenic
1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG + Intronic
1137743667 16:50804838-50804860 TGGTATAAATACCCCCACCACGG + Intergenic
1137848672 16:51716313-51716335 TGGTGTAAATACTCCCAACATGG + Intergenic
1138027135 16:53530897-53530919 TGGTGTAACTCCACCCACCATGG - Intergenic
1138244567 16:55457834-55457856 TGGTGAAAACACACACTTCAGGG + Intronic
1139244649 16:65429700-65429722 TGGCGTAAATACTCCCAACATGG + Intergenic
1140295401 16:73704970-73704992 TGGTGTAAATACTCCCACCATGG + Intergenic
1140591181 16:76354584-76354606 TGGTTTAAATACTCTCATCATGG + Intronic
1140919779 16:79526735-79526757 TGGTGAAAATACTCCCACCATGG + Intergenic
1140990838 16:80209830-80209852 TGGTGTAAATACCTCCACCATGG - Intergenic
1141131428 16:81440116-81440138 TGGTGCAAATACAACCACCATGG - Intergenic
1141270395 16:82534901-82534923 TGGTGTAAATACTCCCACCATGG + Intergenic
1141281936 16:82636811-82636833 TGATGTAAATACTCCCGTCATGG + Intronic
1141335382 16:83149837-83149859 TGGTGTAAATATTACCATCATGG - Intronic
1141479744 16:84298572-84298594 AGGTGTAAATACTCCCAGCATGG - Intronic
1141515710 16:84543638-84543660 TGGTGTAAACACTTCCATTGTGG + Intronic
1141554935 16:84830925-84830947 TGGTGTAAATACTCCCACCATGG - Intronic
1141868646 16:86769066-86769088 TGGTGTAAACACTCTCACCATGG - Intergenic
1203088270 16_KI270728v1_random:1196553-1196575 TGGTGTAAATACTCCTACCATGG + Intergenic
1142589496 17:996093-996115 TGGTGTTAATATCCCCATCATGG - Intergenic
1144030160 17:11313003-11313025 TGGTGTAAAAATTCCCACCATGG + Intronic
1144081925 17:11770886-11770908 TGGTGTAAATACTCCCACCGTGG + Intronic
1144232916 17:13227245-13227267 TGATGTAAACACTCCAACCATGG + Intergenic
1144394320 17:14828824-14828846 TGGTGTAAATACTCCCACCATGG + Intergenic
1144808855 17:17985673-17985695 TGGTGTAAATACTCCCACCGTGG - Intronic
1145788019 17:27606652-27606674 TGGTGTAAATACTCTCACCATGG + Intronic
1145887271 17:28391165-28391187 TGGTGTAAATACTCCCACCATGG - Intronic
1146110835 17:30087649-30087671 TGTGGTATACACACACATCATGG - Intronic
1146403222 17:32516721-32516743 AGCTGTAAACACACACAGCAGGG - Intronic
1146584308 17:34069115-34069137 CAGTGTAAATACTCCCATCACGG - Intronic
1146928225 17:36759707-36759729 TGGTGTAACTACTCCCACCATGG + Intergenic
1147489865 17:40855946-40855968 TTGTGTAAATACTCCCATCATGG + Intergenic
1148609058 17:48951853-48951875 TGGTGTAAATACTCTGATCATGG + Intergenic
1148702108 17:49594533-49594555 CGGTGTAAACACTGCCACCATGG - Intergenic
1149016790 17:51917169-51917191 TGGTGTTAACACCCCTACCATGG + Intronic
1149226927 17:54482863-54482885 TGGTGTAAATGCTCCCATAATGG + Intergenic
1149580490 17:57746971-57746993 TGGTGTAAATACTCCCACCGTGG + Intergenic
1150030128 17:61724955-61724977 TAGTGTAAACACTTCTATCAGGG + Intronic
1150205044 17:63397598-63397620 GGGTGTAAATACTCCCATCATGG + Intronic
1150469436 17:65424298-65424320 TGGTGTAAACACTCTCACCGTGG - Intergenic
1150481384 17:65514193-65514215 TGGTGTAAAGACTTCCACCATGG - Intergenic
1150974225 17:70065839-70065861 TGGTATAAGCTCACCCATCCTGG + Intronic
1151449810 17:74191717-74191739 TGGTGTAAATACTCTCACCACGG - Intergenic
1151784666 17:76269702-76269724 TGGTGTGAACCCATCCACCAAGG + Intronic
1151952081 17:77360458-77360480 TGGTGTAAACACACCCACTGTGG - Intronic
1151989200 17:77563629-77563651 TGGTGTAAATACTCCCAGCATGG + Intergenic
1152232971 17:79124165-79124187 TGGTGTAAATGCTCCCACCAGGG - Intronic
1152990482 18:359238-359260 TGGTGTAAATACTCCCTGCAGGG - Intronic
1153324359 18:3803087-3803109 TGGTGTAAATATTTCCATCACGG + Intronic
1153431871 18:5026387-5026409 TGGTGTAAATAGTCCCACCATGG + Intergenic
1153990198 18:10390285-10390307 TGGTATAAAAACTCCCAGCACGG - Intergenic
1155141172 18:23045948-23045970 TGGTGTAAATACTCCCACCATGG + Intergenic
1155185534 18:23383679-23383701 TTTTGTAAACACACCCTTCCAGG + Intronic
1155413338 18:25570135-25570157 TGGTGTAAATATTCCCACCATGG + Intergenic
1155986482 18:32235957-32235979 AGGTGGAAACAGACCCTTCAAGG + Intronic
1156317845 18:35987554-35987576 TGGTGTACACACACACACAATGG + Intronic
1156704630 18:39864862-39864884 TGATGAACACAAACCCATCAAGG - Intergenic
1156916739 18:42470745-42470767 TTGTGTAAATACTCCCACCATGG - Intergenic
1157096918 18:44694216-44694238 TGGTGTAAACACTCCCACCATGG + Intronic
1157204226 18:45685026-45685048 TGATGTAAATACTCCCACCATGG - Intergenic
1157231697 18:45922924-45922946 TGGTGTAAAAATTCCCACCATGG + Intronic
1157403358 18:47404353-47404375 TGGTGTGAATACTCCCACCATGG - Intergenic
1157471812 18:47994653-47994675 TGGTGTAAATACTCCTATCACGG + Intergenic
1157922693 18:51730042-51730064 TGGTGTAAATACTCTCATCATGG - Intergenic
1158294819 18:55984186-55984208 TGGTGTAAATACTCCCACCATGG - Intergenic
1159064120 18:63550759-63550781 TGGTGTAAATACCCCCATTAAGG - Intergenic
1160573555 18:79834886-79834908 GGATGTGAACACACCCAGCATGG - Intergenic
1160696476 19:487246-487268 TGTTGTAAATACTCCCATCGTGG - Intergenic
1161841937 19:6687205-6687227 TGGTGTAAATACTCCCACCAGGG + Intronic
1161932198 19:7348580-7348602 TGGTGTAAATACCCCCAGCATGG - Intergenic
1162340872 19:10091073-10091095 TGGTGTAAATATTCCCACCATGG + Intronic
1163293907 19:16399602-16399624 TGGTGTAAACAGTCTCATCATGG + Intronic
1165242217 19:34477956-34477978 TGGTATAAATACTCCCAGCATGG - Intergenic
1166237371 19:41466284-41466306 TGGTGTACACCCCCCCATGATGG - Intergenic
1166765375 19:45249841-45249863 TGGTGTAAATATTCCCACCATGG + Intronic
1167172383 19:47841964-47841986 TGGTGTAAATACTCCCACCACGG + Exonic
1167381533 19:49141097-49141119 TGGTGTAAATAATCCCACCATGG - Intronic
1167737940 19:51308600-51308622 TGGTGTAAATCCTCCCAACATGG + Intergenic
1168133065 19:54332956-54332978 TGGTATAAACACTCCCTTCATGG - Intergenic
1168138844 19:54370897-54370919 TGGTGTAAATACTCACAGCATGG - Intergenic
1168159181 19:54497607-54497629 TGGTGTAAATACTCACAGCATGG + Intergenic
1168283057 19:55316161-55316183 TGGTATAAATACTCCCATGATGG + Intronic
925733450 2:6940387-6940409 TGGTTTAAACACTCCATTCAAGG - Intronic
926004296 2:9360596-9360618 TGGTGTAAATACTCCCACAATGG + Intronic
926086169 2:10021706-10021728 TGGTGTAAATATTCTCATCATGG + Intergenic
926798033 2:16634839-16634861 TGGTGTAAATACTTCCACCATGG - Intronic
926965738 2:18408601-18408623 TGGTGTAAATACTCCCACCATGG - Intergenic
927808022 2:26165364-26165386 TAGTGTAAATACACCCACCATGG + Intergenic
928260780 2:29764410-29764432 TGGTGTAAATACTCCTACCATGG - Intronic
928318584 2:30265527-30265549 TGGTGTAAATGCTCCCACCATGG + Intronic
928367623 2:30714811-30714833 TGGTGTAAAGATACGCACCACGG - Intergenic
928886025 2:36149399-36149421 TCGTGTAAATACTCCCTTCATGG + Intergenic
929214041 2:39391766-39391788 TGGTGTAAACACTCCCACCAAGG + Intronic
929442551 2:41976054-41976076 TGGTGTGAAAACTCCCACCATGG + Intergenic
930187469 2:48424661-48424683 TGGTGCAAATACAACCACCATGG + Intergenic
930632093 2:53764705-53764727 TGGTGTAAATACTCCTACCATGG + Intronic
931060780 2:58526986-58527008 TGGTGTAAATATTCCCATCATGG - Intergenic
931952850 2:67384591-67384613 TGGTGTAACTATTCCCATCATGG + Intergenic
932002456 2:67897134-67897156 TGGTGTAAATACTCCCACCATGG - Intergenic
932355329 2:71063803-71063825 TGGTGTAAATACTCCCACCACGG + Intergenic
932587458 2:73040510-73040532 TGGTATAAATACTCCCATCATGG + Intronic
932864507 2:75327518-75327540 TGGGGTGGACACAGCCATCAGGG - Intergenic
934039492 2:88116168-88116190 TGGTGTAAACACTCCCGCGAAGG + Intergenic
934087850 2:88525243-88525265 TGGTGTAAATGCTCCTATCATGG - Intronic
934137072 2:89006288-89006310 GGGAGTAAAAGCACCCATCACGG + Intergenic
934583352 2:95465676-95465698 GTTTGTAAACACACCAATCAGGG + Intergenic
934596098 2:95611038-95611060 GTTTGTAAACACACCAATCAGGG - Intergenic
934786679 2:97014472-97014494 GTTTGTAAACACACCAATCAGGG + Intronic
935209824 2:100929643-100929665 TGGTGTAAATACGCCTACCATGG - Intronic
935787551 2:106562650-106562672 TGGTCAAAACACAGCCATGAAGG + Intergenic
936176334 2:110223852-110223874 TGGTGTAAAGACAGACATAATGG - Intergenic
936591213 2:113806497-113806519 TGGTGTAAATACTCCCACCACGG - Intergenic
938105661 2:128528274-128528296 TGGTCTAAAAACTCCCACCAAGG + Intergenic
938747406 2:134292740-134292762 TGGTGTTAACACTCCGAGCAAGG + Intronic
939086762 2:137728962-137728984 TGGTGTAAATACTCCCTCCAAGG - Intergenic
939407730 2:141780543-141780565 TGGTGTAAATTCTCCCACCACGG + Intronic
939495715 2:142925715-142925737 AGGTATAAATACTCCCATCATGG - Intronic
939660485 2:144882723-144882745 TGGTGTAAATACTCCTGTCATGG + Intergenic
940757018 2:157694751-157694773 TGGTGTAAATACTTCCACCATGG + Intergenic
942078163 2:172376141-172376163 TGATGTAAATACTCCCATAATGG - Intergenic
943663268 2:190581898-190581920 TGGTGTAAATACTCCCATCATGG - Intergenic
944125314 2:196286166-196286188 TGGTGTAAATTCTCCCAACATGG - Intronic
944311560 2:198239296-198239318 TGGTGTAAACCTGACCATCATGG + Intronic
944351187 2:198729197-198729219 TGGTGTAAACAGAACCATCATGG - Intergenic
945572987 2:211493977-211493999 TGATGTAAATACTCCCAACATGG + Intronic
945834139 2:214819427-214819449 TGGTGTAAATACTCTCACCATGG - Intergenic
946117539 2:217476556-217476578 TGGTGCAACTACTCCCATCATGG + Intronic
946436224 2:219657431-219657453 TGGTGTAAATACTCCCACAATGG - Intergenic
946463366 2:219889866-219889888 TGGTGTAAATACCCCTACCATGG - Intergenic
946592245 2:221263284-221263306 TAGTGTAAACACTCCCCCCATGG - Intergenic
946600976 2:221359822-221359844 TGGTGTAAATACTCCTACCATGG + Intergenic
947395327 2:229681121-229681143 TTGTGTAAACACTCCCAGTATGG + Intronic
947589593 2:231378007-231378029 TGGTGTAAATACCCCCACCATGG - Intergenic
948203129 2:236144056-236144078 TGGTGTAAATACTCCCACCATGG - Intergenic
948578471 2:238969024-238969046 GGGCTTAAACAAACCCATCAGGG - Intergenic
948649756 2:239434366-239434388 TGGTGTAAATACTCCTACCAAGG - Intergenic
948660721 2:239504962-239504984 TAGTGTAAACACTCCCACCACGG + Intergenic
948778252 2:240301186-240301208 TGGTGTAAACACTCCTGGCATGG - Intergenic
1168931586 20:1628831-1628853 TGGTATAATCACCCCCAACATGG - Intergenic
1169050138 20:2569157-2569179 TGGTCTAAATACTCCCACCATGG + Intronic
1169519231 20:6353161-6353183 TGGTGTAAATACCCCCACCATGG + Intergenic
1169825622 20:9765590-9765612 TGGTGTGAATACTCCCATCATGG - Intronic
1170020204 20:11829184-11829206 TCATGTAAACACTCCCACCATGG - Intergenic
1170145477 20:13169294-13169316 TGGTGTAAATACTCCCATTGTGG - Intergenic
1170345377 20:15380690-15380712 TGGTGTAAACAGTTCCATCATGG - Intronic
1170474241 20:16699236-16699258 TGGTGTAAATACTCCCACCATGG - Intergenic
1170603254 20:17857922-17857944 TGGTGTAAACGCTCCCACCATGG - Intergenic
1170731408 20:18979045-18979067 TGGTGCAAACTCAACCACCAGGG - Intergenic
1170786429 20:19471556-19471578 TGGTATAAATACCCCCATAATGG + Intronic
1170815264 20:19708621-19708643 TGGTGTAAATACTGCCATCATGG - Intronic
1170835540 20:19881256-19881278 TGGTGTAAATACTCCCATCATGG - Intergenic
1172195906 20:33091308-33091330 TGGTATCAAAACTCCCATCATGG + Intronic
1172224049 20:33292301-33292323 TGGTGGAAATACTCCCTTCAGGG + Intronic
1172578646 20:36029490-36029512 TAGTGTAAATACTCCCACCATGG + Intronic
1172742137 20:37177306-37177328 TGGTGTAAATACTCCCATCATGG + Intronic
1173054802 20:39601083-39601105 TGGTGTAAATACTCCCACCATGG - Intergenic
1173941229 20:46913100-46913122 TGGTGTAAATACTCCCACCATGG + Intronic
1174006808 20:47417389-47417411 TGGTGTAAATACTTCCACCATGG - Intergenic
1174067112 20:47873530-47873552 TGGTGTAAATATTCCCACCATGG + Intergenic
1174157145 20:48523024-48523046 TGGTATAAATACTCCCAACATGG - Intergenic
1174420798 20:50397893-50397915 TGGTGTAAATAGTCCCACCATGG + Intergenic
1174686418 20:52460142-52460164 TGGTGTAAATACTCCCACCATGG - Intergenic
1174687993 20:52474088-52474110 TGGCGTAAATACTCCCACCATGG + Intergenic
1174853374 20:54018763-54018785 TCAAGTAAATACACCCATCATGG - Intronic
1175120292 20:56711254-56711276 GTGTGTAAACACACCGCTCAAGG - Intergenic
1175369096 20:58475016-58475038 TGGAATAACCACACCCATCTAGG - Intronic
1175609700 20:60340361-60340383 TGGTGTAAATACTCCCACAATGG + Intergenic
1175802481 20:61808830-61808852 TGATTTAAACAAACACATCAGGG - Intronic
1178423655 21:32461656-32461678 TGGTGTAAATACTCCCACCGTGG - Intronic
1178503626 21:33145701-33145723 TGGTGTAAATACTCCCACCGTGG - Intergenic
1178632078 21:34270556-34270578 TGGTTTAAATACTCCTATCATGG - Intergenic
1178812396 21:35896025-35896047 TGGTGTAAACACTCCCCCTATGG + Intronic
1178821568 21:35980210-35980232 TGGTGTAAATACTCCCATTGTGG + Intronic
1179254323 21:39701973-39701995 TGATGTAAACACTCCCACCATGG + Intergenic
1179726739 21:43345194-43345216 TGGTGCAAACACTCCCAGCATGG - Intergenic
1180730885 22:17981589-17981611 TGGTGTAAATGCTCCCACCAAGG + Intronic
1181790212 22:25259527-25259549 TGGTGTAAATACTACCATCATGG + Intergenic
1181826024 22:25516538-25516560 TGGTGTAAATACTACCATCATGG + Intergenic
1181870711 22:25896801-25896823 TGGTGTAAATACTCCCACCATGG + Intronic
1181994990 22:26870437-26870459 TGATGTAAATACTCCCACCATGG - Intergenic
1182038490 22:27218028-27218050 TGGTGTGTACACATCCTTCACGG - Intergenic
1182840612 22:33386566-33386588 AGGTGTAAACACTCCCATCATGG + Intronic
1183233083 22:36595391-36595413 TGGTGTGAATACACCTACCACGG - Intronic
1183385921 22:37514563-37514585 TGGCCTCAACACCCCCATCAGGG + Intronic
1183675308 22:39295939-39295961 TGGTGTAAACATACCCACCACGG - Intergenic
1183737471 22:39651789-39651811 TGGTGTAAATACTCCCTCCACGG - Intronic
1184540768 22:45122726-45122748 TGGTGTAACTACTCCCACCATGG + Intergenic
1184903281 22:47461262-47461284 TGGTGTAAACACTCCCACCATGG - Intergenic
1184998858 22:48229590-48229612 TGGTGTAAATACCCCCACCAGGG - Intergenic
949923835 3:9025062-9025084 TGGTGTAAACACGCCAGCCATGG + Intronic
949946676 3:9195052-9195074 TGGTGTAAATATTCCCACCATGG + Intronic
950195442 3:11006085-11006107 TGGTGTAAACACTCCCACTGTGG - Intronic
950279140 3:11691487-11691509 TGGTGTAAATACACCCATCATGG + Intronic
950430640 3:12949007-12949029 TATTTTAAACACACCCACCACGG - Intronic
950778362 3:15369853-15369875 TGGTGTAAATACTCCCATCACGG - Intergenic
950900864 3:16496202-16496224 TGGTGTAAACACACCCACCATGG + Intronic
951109512 3:18785518-18785540 TGGTGTAAATACTCCCACCCTGG + Intergenic
951128022 3:19006915-19006937 TGGTGTAAACATTTTCATCATGG - Intergenic
951245458 3:20336200-20336222 TGGAGTAAATACTCCTATCATGG + Intergenic
951369210 3:21824828-21824850 TGGTGTAAAAACAGTCATCAAGG - Intronic
951996741 3:28738141-28738163 TGCTGTAAATACTCCCATTATGG + Intergenic
952177114 3:30876413-30876435 TGGTGTAAAGACGCCGATCATGG + Intronic
952974924 3:38685623-38685645 TAGTGTAAACACTTCCACCATGG - Intergenic
953526404 3:43693291-43693313 TGGTGTAAATACTCCCACCATGG - Intronic
953532501 3:43751336-43751358 TAGTGTAAATACCCCCACCATGG - Intergenic
953715903 3:45316842-45316864 TGGTGTAAATACTCCCACCATGG + Intergenic
953736122 3:45495322-45495344 TGATGTACATACTCCCATCAGGG + Intronic
953982486 3:47419654-47419676 TGGTATACACAGACCCAGCAGGG - Exonic
955071426 3:55575518-55575540 TGATGGAAACAAACCCAGCAGGG + Intronic
955261459 3:57395234-57395256 TGATGTAAAAACTCCCACCATGG - Intronic
955446314 3:59014917-59014939 TGGTGTAAATATTCCCACCATGG - Intronic
955776841 3:62442590-62442612 TGGTGTAAATACTCCCATCAAGG + Intronic
955989128 3:64606325-64606347 TGGTGTAAATACTCTCATCATGG + Intronic
956708001 3:72015859-72015881 TGGTAGTATCACACCCATCAAGG - Intergenic
956724259 3:72144192-72144214 GGGTGTAAATACTCCCACCATGG + Intergenic
956727596 3:72169205-72169227 TGGTGTAAATACTCCTACCATGG - Intergenic
956935267 3:74093815-74093837 AGGTGTAAATACTCCCACCACGG - Intergenic
958152713 3:89711820-89711842 TGTTGTAAATACACTCATCATGG - Intergenic
958737998 3:98031993-98032015 TGGTGTAAATACTTCCACCATGG + Intronic
959608204 3:108264983-108265005 TGATGTAAATATTCCCATCATGG - Intergenic
960140952 3:114151464-114151486 TGGTGTCAATACTCCCACCATGG + Intronic
960151353 3:114251815-114251837 TGGTGTAAACACTCCCACTGTGG - Intergenic
960884822 3:122383454-122383476 TGGAGTAAACAGTCCCTTCAAGG - Intergenic
961146175 3:124595378-124595400 TGGTATAAATACTCCCACCATGG - Intronic
962471551 3:135713365-135713387 TGGTATAAATACTCTCATCATGG + Intergenic
962711229 3:138087944-138087966 TGGTGTAAATACTCCCAGCATGG - Intronic
963444215 3:145382900-145382922 TGGTGTAAATACACCCACCATGG - Intergenic
963674131 3:148287067-148287089 TGGGATAAACTTACCCATCAAGG - Intergenic
964090644 3:152872338-152872360 TAGTGTAAATACTCTCATCATGG - Intergenic
964758791 3:160114316-160114338 TGGTTTAAATACTCCCTTCATGG - Intergenic
966778333 3:183562337-183562359 TGGTGTAAATATCCCTATCATGG - Intergenic
967291776 3:187927845-187927867 TGGTGTAAATATTCTCATCATGG + Intergenic
967953488 3:194859029-194859051 TGGTGTAAATACTCCCACCATGG - Intergenic
968436203 4:590996-591018 TGGTGTAAATGCCCCCCTCATGG - Intergenic
969111835 4:4849262-4849284 TTGTTTAAACAGACCCCTCAGGG - Intergenic
969195910 4:5563699-5563721 TGGTGTAAATATTCCCACCATGG - Intronic
969242820 4:5912139-5912161 TGGTGTAAACACTCCTACTATGG + Intronic
969664407 4:8548860-8548882 TGGTGTAAACACTCTCATCTTGG - Intergenic
969690137 4:8699651-8699673 TGGTGTAAACCCTCTCCTCAGGG - Intergenic
970499535 4:16663327-16663349 TGGTGTAAATTCTCCCACCATGG + Intronic
971272380 4:25162136-25162158 TGGTGTAAATGCTCCCACCATGG - Intronic
972410543 4:38789233-38789255 TGGTGTAAATACTCCTACCATGG - Intergenic
972791332 4:42374031-42374053 GATTGTAAACACACCAATCAGGG - Intergenic
974188053 4:58465519-58465541 GTTTGTAAACACACCAATCAGGG + Intergenic
974411496 4:61546639-61546661 TGGTGTAAATACTCCCTTCAGGG - Intronic
976140038 4:81981689-81981711 TGGTGTAAATACTCCCACCATGG - Intronic
976281096 4:83327784-83327806 TGGTGTAAATACTCCCTCCATGG - Intronic
976924021 4:90474584-90474606 TGATGTAAATACACCCACCATGG - Intronic
977429208 4:96910237-96910259 TGGTGTAAATATTCCCACCATGG + Intergenic
977537456 4:98271418-98271440 TGGTGTAAATACTCCCCCCATGG + Intronic
978120813 4:105077350-105077372 TGGTGTAAATACTCCCACTACGG - Intergenic
978274511 4:106933520-106933542 AGCTGTCAACACACCCATTATGG + Intronic
978745523 4:112189795-112189817 TGGTGTAAATACTCTCACCATGG - Exonic
979443884 4:120787465-120787487 TGTTGTCAACACAGCCATCAAGG - Intronic
979597571 4:122551244-122551266 GGGTGATAACACACCCAACAGGG - Intergenic
980092753 4:128459524-128459546 TGGTGTAAACACTCTCACCATGG - Intergenic
980380570 4:132009821-132009843 TGGTGTAAATACGCACAACATGG + Intergenic
981598491 4:146456017-146456039 TGGTGTAAATACTCCCACCACGG + Intronic
982921367 4:161277775-161277797 GTTTGTAAACACACCAATCAGGG + Intergenic
983260799 4:165454064-165454086 TGGTGTAAATACTCCCATCCTGG + Intronic
983261080 4:165457266-165457288 TGGTGTAAATACTCCCACCCTGG - Intronic
983859631 4:172688979-172689001 TGGTGTAAATACTCCCATTGTGG - Intronic
984756101 4:183326950-183326972 TGGTGTAAATACTCTCACCATGG + Intergenic
984979091 4:185260461-185260483 TGGTGTAAACACTCTCACCATGG - Intronic
985150305 4:186940582-186940604 TGGTGAAATCACAACCACCAGGG + Intergenic
986062098 5:4201529-4201551 TGGTGTAAACCCCCCTTTCATGG - Intergenic
987011029 5:13765156-13765178 TAGTGTAAGCACTCCCATGATGG - Intronic
987026329 5:13930307-13930329 TGGTGTAAATACTCCCACAATGG - Intronic
987342050 5:16947982-16948004 TGGTGTAAATACTCTCACCATGG + Intergenic
987444818 5:18004734-18004756 TGGTGTAAACACAATTATCTTGG - Intergenic
987685861 5:21200092-21200114 TGGTGTATACACACCAAGAATGG - Intergenic
988499782 5:31774955-31774977 TGGTGTAAACACTCCCACCATGG + Intronic
988713433 5:33801305-33801327 GGGTGTAAATACTCCCACCATGG - Intronic
988873757 5:35420370-35420392 TAGTGTAAATACTCCCATCATGG + Intergenic
989106569 5:37868564-37868586 TGGTGTAAATCCTCCCACCATGG + Intergenic
989485007 5:41979545-41979567 TGGTTTAACCACTCCCAACATGG + Intergenic
989982053 5:50656778-50656800 TGGTGTAAATACTCCCACCATGG + Intergenic
990469655 5:56103308-56103330 CGGTGTAAATACACCCACCATGG - Intronic
990978354 5:61578804-61578826 TGGTGTAAATACTCCCACCATGG - Intergenic
991675143 5:69083394-69083416 TGGTGTACATACCCCCACCATGG - Intergenic
991932156 5:71764597-71764619 TGGTGTAAATACTCCCAGCATGG + Intergenic
992848557 5:80780216-80780238 TAGTGTAAACACTCCCACCAGGG + Intronic
993489282 5:88526424-88526446 TGGTGTAAATACTCCCACCATGG + Intergenic
993547822 5:89234169-89234191 TGGTGTAAACGCTACCACCATGG - Intergenic
994380969 5:99070875-99070897 TGGTGTTAAAACTCCCACCAAGG - Intergenic
995403636 5:111769176-111769198 GGGAGTAACCACAGCCATCAGGG - Intronic
995748101 5:115425011-115425033 TGGTGTAAATACTCCCATCTTGG + Intergenic
996026047 5:118647202-118647224 TGATGTAAATAGTCCCATCATGG - Intergenic
996287688 5:121813583-121813605 GGGAGGAAACACACCCATCTGGG + Intergenic
996334875 5:122372308-122372330 TGGTGTAAATACTCCCAGCATGG + Intronic
997613035 5:135228482-135228504 TGGTGTAAATATTCCCACCATGG + Intronic
997780531 5:136653182-136653204 TGCTTTAAACACAGCCAGCATGG + Intergenic
999687264 5:154114471-154114493 TGGTGTAAACATTCCCACCCTGG - Intronic
1000005850 5:157184292-157184314 TGGTGTAAATATTCCCATCATGG + Intronic
1000222904 5:159231272-159231294 TGGTATAAATACTCCCACCAAGG - Intergenic
1000455984 5:161449682-161449704 TGTAGTACACACACCCATAAGGG - Intronic
1001517282 5:172364813-172364835 TGGTGTAAATACTCCCACCATGG - Intronic
1001581587 5:172802185-172802207 TGGTGTAAACATACCCACTGTGG - Intergenic
1001786011 5:174414055-174414077 CGGTGTAAATACTCCCACCATGG - Intergenic
1002854526 6:1025653-1025675 TGATGTGAACACACTCACCATGG + Intergenic
1003138076 6:3448313-3448335 TGGTGTAAATGCTCCCACCATGG + Intronic
1003522552 6:6870718-6870740 TGGTGTAAATACTCCCACCATGG + Intergenic
1004013643 6:11712424-11712446 TGGTGTAAACACTCTCCCCATGG - Intronic
1004539292 6:16534529-16534551 TAGTGTAAACACTCCCACCATGG + Intronic
1005033278 6:21531392-21531414 TGGTGTAAACACTCCCATCATGG + Intergenic
1005054100 6:21713751-21713773 TGGTGTACACACACACATACAGG - Intergenic
1005971243 6:30763590-30763612 TGGTGTAAATACTTCCATCAAGG - Intergenic
1006130363 6:31865435-31865457 TGGTCTAGACACCCCCATCCTGG - Intronic
1007058500 6:38913215-38913237 TAGTGTAAACACTCCCACCATGG - Intronic
1007733478 6:43965952-43965974 TGGTGTAAATACTCCCACCATGG - Intergenic
1007997859 6:46327776-46327798 TGGTGTAAATATGCTCATCATGG + Intronic
1008308240 6:49932641-49932663 TGGTGTAAATACTCCTAACACGG + Intergenic
1008929575 6:56924242-56924264 TGGTATAAACACTCCCATCATGG + Intronic
1010399946 6:75436876-75436898 TGGTGTAAATACCCCCATCATGG + Intronic
1010577779 6:77553977-77553999 TGATATAAATACTCCCATCATGG - Intergenic
1011670899 6:89682119-89682141 TGGTGTAAATACTCCTATTATGG - Intronic
1011727635 6:90226436-90226458 TGGTGTAAACTCTCCCACCATGG + Intronic
1011787264 6:90861063-90861085 TGGTGTAAATACTCCCACCATGG - Intergenic
1011897878 6:92254505-92254527 TGGTGTAAATACTCCCACCATGG + Intergenic
1012097529 6:94982334-94982356 TGGAGTAAATACACCCACTATGG + Intergenic
1012424754 6:99101576-99101598 TGTGGTAAGCACATCCATCATGG - Intergenic
1013123620 6:107161978-107162000 TGGTATAAATACTCCCATTATGG + Intronic
1014494149 6:122099866-122099888 GTTTGTAAACACACCAATCAAGG + Intergenic
1016054832 6:139567428-139567450 TGGTCTAAACACTCCCTCCATGG + Intergenic
1016145662 6:140669561-140669583 TGGAGTAATCACAACCATCTAGG - Intergenic
1016917510 6:149258287-149258309 TGGTGTAAATACTCCCACCATGG + Intronic
1017051649 6:150399250-150399272 TGATGTAAACTCTCCCACCATGG - Exonic
1017820953 6:158048766-158048788 TGGTGTAAATTCTCCCATCGTGG + Intronic
1018254313 6:161903275-161903297 TGGTGTAAATACACCCATCTGGG - Intronic
1019489486 7:1305358-1305380 TGGTGTAAATACTCCCACCAAGG - Intergenic
1019816260 7:3203079-3203101 TGGTGTGAATACTCCCACCATGG - Intergenic
1019972447 7:4551935-4551957 TGGTGTAAACATTCCCACCATGG - Intergenic
1020025984 7:4900492-4900514 TGGTGTAAACACTCACACCTTGG + Intergenic
1020867083 7:13579127-13579149 TGGTGTAAGCACTCTCACCATGG + Intergenic
1021126352 7:16854577-16854599 TGGTGTTTCCCCACCCATCATGG + Intergenic
1021298704 7:18942764-18942786 TGGTGTAAATATTCCCACCATGG - Intronic
1022177958 7:27890223-27890245 TGGTGTAAATACTCCCACCATGG + Intronic
1022450298 7:30507566-30507588 GTTTGTAAACACACCAATCAGGG - Intronic
1022483084 7:30756773-30756795 TGGTGTAAATACTCCCACCATGG + Exonic
1022985308 7:35648432-35648454 TGGTGTAAATACTCCCATCATGG - Intronic
1023148933 7:37181350-37181372 TGGTGTAACCCCACCCTGCAGGG - Intronic
1023479635 7:40620174-40620196 AGGTGTAAATACCCCCAACAAGG - Intronic
1023855159 7:44178495-44178517 TGGTTTAAATACACCCACCATGG + Intronic
1024292790 7:47817258-47817280 TGGTGTAAATCCTCCCACCATGG - Intronic
1026407293 7:70079724-70079746 TGGTGTAAATACTTCCACCATGG - Intronic
1027164978 7:75827937-75827959 TGGTGTAAATCCTCCCACCACGG + Intergenic
1028001326 7:85501780-85501802 TGGTTTAAATGCACCCTTCATGG - Intergenic
1028325599 7:89520835-89520857 TGGTGTAAACACTCCCACTGTGG - Intergenic
1029251465 7:99239737-99239759 TGGTATAAATACTTCCATCACGG - Intergenic
1029588495 7:101491282-101491304 TGGTGTAAATACTCCCAGCATGG - Intronic
1029795731 7:102892898-102892920 TGGTGTAAATACTCTCACCATGG - Intronic
1030082919 7:105792724-105792746 TGGTGTAAATACTTCCACCATGG - Intronic
1030165018 7:106545360-106545382 TGGTGTAAACACTTCCACCACGG - Intergenic
1030451267 7:109715277-109715299 TGGTGTTAACAGAGCTATCATGG + Intergenic
1031027230 7:116693329-116693351 TGGTGTCAATACAGCCACCATGG + Intronic
1031162979 7:118190511-118190533 TTGTGCAAACACTCCCACCACGG - Intronic
1031708147 7:125008701-125008723 TGGTGTAAATATTCCCATCATGG - Intergenic
1032627662 7:133609827-133609849 TTGTGTAACTACACCCATCGTGG - Intronic
1032746139 7:134788352-134788374 TGGTGTAATTACTTCCATCATGG - Intronic
1032862584 7:135894648-135894670 TGGTGTAAATAATCTCATCATGG + Intergenic
1035920684 8:3672724-3672746 TGGTTTAAATACATCCACCATGG - Intronic
1037493125 8:19414099-19414121 TGGTGTAAATACTCCCACCGTGG - Intronic
1038073743 8:24046664-24046686 GGGTGGAAACCCACTCATCAGGG - Intergenic
1038193307 8:25343749-25343771 TGGTGTAAAGACTTCCACCATGG - Intronic
1039584259 8:38692694-38692716 TGGTCTGAAGACCCCCATCAAGG + Intergenic
1039853798 8:41395535-41395557 TGGTGTTAATACACCTACCATGG - Intergenic
1040537262 8:48321160-48321182 TGATGTAAATACTCCCACCACGG - Intergenic
1040615033 8:49026988-49027010 TGGTGTACATACGCCCACCAGGG + Intergenic
1041337409 8:56802043-56802065 TGGTGTAAATAATCCCATCATGG - Intergenic
1041468750 8:58184916-58184938 TGGTATAAATATACCCACCATGG - Intronic
1042218214 8:66448578-66448600 TGGTGTAAATACTCTCACCATGG + Intronic
1043190480 8:77215362-77215384 TGGTGTAAATACTCCTACCATGG - Intergenic
1043885787 8:85598934-85598956 TGGTATAAATACTCCCACCATGG + Intergenic
1044260405 8:90113165-90113187 TGGTGTAAATACTCCCACCATGG + Intergenic
1044305106 8:90630589-90630611 TGGTGTAAATATTCCCATCATGG + Intronic
1045010477 8:97954492-97954514 TGGTGTAAATACTCCCACCGTGG + Intronic
1045463323 8:102445801-102445823 TGGTGCAAATACTCCCACCATGG + Intergenic
1045912130 8:107423149-107423171 TGGTGTAAATACTCCTACCATGG - Intronic
1047297674 8:123585718-123585740 GGGTGTAAATATTCCCATCATGG - Intergenic
1047332541 8:123904924-123904946 TGGTGTAAATATTCCCACCATGG - Intronic
1050245988 9:3690571-3690593 TGGTGTAAATACTCCCACCATGG + Intergenic
1050475403 9:6035183-6035205 TGCTGTAAACACTCACATGAAGG + Intergenic
1050665368 9:7929960-7929982 TGCTGTAAATACCCCCATCATGG + Intergenic
1051037888 9:12771024-12771046 TGGTGTAAATACTCTCATTATGG - Intergenic
1051180719 9:14409117-14409139 TGCTGTAAACATTTCCATCATGG + Intergenic
1051344210 9:16137945-16137967 TGGTGTAAATATTCCCATCATGG - Intergenic
1051359140 9:16266378-16266400 TGGTGTAAATACTCCCACCATGG + Intronic
1052177232 9:25477160-25477182 TGGTGTTAACATACCTGTCATGG - Intergenic
1054942850 9:70762858-70762880 TGGTGTAAACAGAGGCAACATGG - Intronic
1055240679 9:74182774-74182796 TGGGGTAAATACTCCCAGCAGGG - Intergenic
1055444328 9:76367744-76367766 TGGTGTAAGTACTCTCATCATGG + Intergenic
1057006017 9:91560656-91560678 TGGTGTAAATACTCCCACCATGG + Intergenic
1057832202 9:98416094-98416116 TGGTGTAAATACACCCACCATGG + Intronic
1057834637 9:98434507-98434529 TGGCATAAATACTCCCATCATGG + Intronic
1058513372 9:105743730-105743752 TGATGTAAATACTCACATCATGG - Intronic
1059126204 9:111688164-111688186 TGGTATGAAGACACCCACCATGG + Intronic
1059412766 9:114143513-114143535 TGGTGTAAAGATGCCCATCGTGG - Intergenic
1059799176 9:117732232-117732254 TGGTGTAAATACTCCCACCATGG + Intergenic
1059861461 9:118467761-118467783 TAGTGTAAACATACCCCTCATGG - Intergenic
1060168381 9:121440042-121440064 TGGTTTAAATACTCCCACCACGG + Intergenic
1060398401 9:123332607-123332629 TGGTGTAAATACTCCCACTATGG + Intergenic
1061205621 9:129161473-129161495 TGGTGTAAACACTCCCATTTTGG - Intergenic
1061761606 9:132855523-132855545 TGGTGTAGACACTCCCACCGTGG - Intronic
1061912658 9:133733266-133733288 TGGTGTGAACACTCCCACCCTGG - Intronic
1186321879 X:8436503-8436525 AGGGGTATTCACACCCATCAAGG + Intergenic
1186520065 X:10198012-10198034 TGGTGCAAATACACGCACCAGGG - Exonic
1186525912 X:10248146-10248168 TGGTGTAAACATTTCCACCATGG - Intergenic
1187196138 X:17086485-17086507 TGGTGTAAACACTCCTGCCATGG + Intronic
1187231326 X:17426179-17426201 TAGTGTAAATACTCTCATCATGG - Intronic
1187565652 X:20447042-20447064 TGGTGTAAATACTCCCACTATGG + Intergenic
1187580517 X:20602783-20602805 TGGTGTAAATACCCCCACCATGG + Intergenic
1188924718 X:36024655-36024677 TGGTTTAAACACTCCCTCCATGG + Intergenic
1189061780 X:37761419-37761441 TGGTGTAAATACTTCCACCATGG - Intronic
1189204363 X:39225206-39225228 TGGTGTAAATACCCCCGCCATGG + Intergenic
1189277059 X:39794410-39794432 TGGTGTAAATACTCTCATGATGG + Intergenic
1189307332 X:39996713-39996735 TGGTGTAAATACTCCCACCAGGG + Intergenic
1189578028 X:42375851-42375873 TGGTGTAAATACTTCCACCATGG + Intergenic
1189680984 X:43515664-43515686 TGGTGTAAATATTCCTATCATGG - Intergenic
1189944309 X:46162561-46162583 TGGTGTAAATACTCCCACCGTGG - Intergenic
1190431622 X:50383259-50383281 TGGTGTAAACCCTTCCACCATGG - Intronic
1191865555 X:65700837-65700859 TGGTATAAATACTCCCACCATGG + Intronic
1192393220 X:70752991-70753013 TGGTTTAAACACCCCCTCCACGG - Intronic
1192948371 X:75989869-75989891 TGGTGGAAAAACTCCCATCATGG - Intergenic
1193007028 X:76631375-76631397 TGGTGTATATATACACATCATGG - Intergenic
1194639403 X:96384838-96384860 TGGTGTAAATACTCTCACCATGG - Intergenic
1195090514 X:101454240-101454262 TGGTGTAAATACTTCCATCATGG + Intronic
1195684015 X:107569664-107569686 TGGTGTACATACACCCACCATGG - Intronic
1195770802 X:108349034-108349056 TGGTATAAATACTCCCACCAAGG - Intronic
1195906760 X:109851849-109851871 TTGTGTAAACACTCCCACCATGG - Intergenic
1196051583 X:111311493-111311515 TGGTGTAAATATTCCCACCATGG + Intronic
1197224704 X:123945340-123945362 TGGTGTAAATACTCCCATCATGG + Intergenic
1197651238 X:129067139-129067161 TGATGTAAATACACTCACCAAGG - Intergenic
1197679576 X:129367889-129367911 TGATGTAAATACTCCCACCATGG + Intergenic
1198226383 X:134649471-134649493 TGGTGTAAATGCTCCCACCATGG - Intronic
1199438182 X:147837788-147837810 TGGGGTAAATACTCCCACCATGG - Intergenic