ID: 1137415217

View in Genome Browser
Species Human (GRCh38)
Location 16:48270706-48270728
Sequence AAACTTCCTCTTATGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137415217 Original CRISPR AAACTTCCTCTTATGAAGGT TGG Intronic
902716457 1:18276144-18276166 ACACTTCCTCTTGCAAAGGTGGG + Intronic
908481009 1:64539452-64539474 AAAGTGCCCCTTATGAAGCTTGG + Intronic
909717056 1:78721804-78721826 AAACTGCCTCCTAGGAGGGTGGG - Intergenic
910434758 1:87194370-87194392 AAAGTACCTCTTCTGAAAGTAGG + Intergenic
910892671 1:92033871-92033893 AAACTTCATCATATGAATTTTGG + Intronic
912947524 1:114097247-114097269 ATTCCTCCTCTTATGAATGTTGG - Intronic
913038792 1:115002722-115002744 AAACCACCTCTTAGGAAGATAGG + Intergenic
914453529 1:147814583-147814605 ACACTTCTTCTTTGGAAGGTAGG - Intergenic
915681504 1:157586107-157586129 AAACTTCCTCAAATTAAGGGTGG - Intronic
915808267 1:158877389-158877411 AAACTTCCTCATAAGGAGTTAGG - Intergenic
918092495 1:181309589-181309611 AACCTTCCTCTTATGATGGTTGG + Intergenic
920347170 1:205313868-205313890 AGACTTCCTCTTATGGGGGTAGG + Intronic
922513514 1:226188794-226188816 AATCTTCCACTTCTGATGGTTGG + Intergenic
922591170 1:226778363-226778385 AAACTTTCTCTTATGAAAAGGGG - Intergenic
1063012945 10:2043595-2043617 AAACTTCATATTATTAATGTGGG + Intergenic
1065140947 10:22717483-22717505 AAACATCCTATAATGTAGGTAGG - Intergenic
1067218943 10:44327739-44327761 AAGCTTCCTCATGTGAAGGGTGG + Intergenic
1071861066 10:89673257-89673279 ACAATTCCTCTTATTAATGTTGG - Intergenic
1073963212 10:108957715-108957737 AAATTTCCTTTTATGAATTTTGG + Intergenic
1074736123 10:116435339-116435361 AATCTTCCTCTTAGGAAACTGGG + Intronic
1075139140 10:119815954-119815976 AAACTTGTTCCTTTGAAGGTTGG + Intronic
1079330047 11:19525795-19525817 AAACTTCCTCAAAGGAAGGGAGG - Intronic
1079551463 11:21704042-21704064 CAACTTCCTCTAATGAAGGTAGG - Intergenic
1080374336 11:31690005-31690027 AATGTTCCTCTCATGAAGGAAGG + Intronic
1080495414 11:32812885-32812907 AATCTTTCACTTATGAATGTAGG + Intergenic
1080758346 11:35223865-35223887 AAACTTTCTCTGATGAAAATAGG - Intronic
1082215952 11:49569781-49569803 AAACTTCCTTTTGTGAAGTGAGG - Intergenic
1084027120 11:66457877-66457899 ACAATTCCTCTCATCAAGGTTGG + Intronic
1085835004 11:79945318-79945340 ATAATTCCTCTTATGAAAATAGG + Intergenic
1086633626 11:89054697-89054719 AAACTTCCTTTTGTGAAGTGAGG + Intronic
1087185211 11:95184037-95184059 AAACTGCCTTTTTTGTAGGTGGG - Intronic
1093799183 12:23351432-23351454 AAACCTCCTTTTATGAAATTAGG + Intergenic
1094773280 12:33690972-33690994 GAAGTTCCTCTTCTGTAGGTGGG - Intergenic
1096663172 12:53142076-53142098 GATCTTCCTCATATGAAGGAAGG - Intergenic
1098679654 12:73336274-73336296 GAACTTCCTCTTATTAATATAGG - Intergenic
1098687058 12:73434950-73434972 AAACTTCTTCCTAAGATGGTTGG + Intergenic
1099518637 12:83630539-83630561 GAACTTCTACTTATGATGGTTGG + Intergenic
1100693131 12:97060942-97060964 AAATTACCTCTTATGAAGGGTGG - Intergenic
1104313881 12:127679293-127679315 AAGCTTCCTCTCGTGAAGGAAGG - Intergenic
1106685146 13:32050665-32050687 AAACTTCCTCACATAAGGGTGGG - Intronic
1112105467 13:96234841-96234863 AAACTTCCTCTGAAGACAGTTGG + Intronic
1116342328 14:43739795-43739817 AAACTTCCCCATATGTAGTTAGG - Intergenic
1118087090 14:62430249-62430271 AAAGTTCCCATTTTGAAGGTGGG + Intergenic
1119093472 14:71806607-71806629 AAAGTTGATCTTATGGAGGTAGG + Intergenic
1119277269 14:73369628-73369650 TAAGTTCCTCTTTTGGAGGTGGG - Intronic
1120566063 14:86058838-86058860 AAACTTCATCTTTTGCAGTTAGG + Intergenic
1125054867 15:35346682-35346704 AGCATTCCTCTTAAGAAGGTAGG - Intronic
1129675368 15:77630409-77630431 AAACAACCTCTTGTGGAGGTGGG - Intronic
1134367291 16:13591328-13591350 AAACTTCCAATTATTAAGGTTGG - Intergenic
1137415217 16:48270706-48270728 AAACTTCCTCTTATGAAGGTTGG + Intronic
1138709947 16:58960295-58960317 AACCTGCCTTTTAAGAAGGTGGG - Intergenic
1142722669 17:1787177-1787199 AAACTTCCTATTCTGAAAATGGG - Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1150302534 17:64058298-64058320 ACACTTCCTCCTTTGATGGTAGG + Intronic
1150324513 17:64246014-64246036 ACACGTCCTCACATGAAGGTGGG - Intronic
1150863589 17:68826118-68826140 AGACTTCCTCTCTTGAAGGGAGG + Intergenic
1150947298 17:69761856-69761878 AAACTTGGACTTTTGAAGGTAGG + Intergenic
1153162216 18:2219646-2219668 AAACCTCCTCTTTTTAAGATTGG - Intergenic
1153537924 18:6122706-6122728 AATCTTCCTTTTATGAATGAGGG - Intronic
1155100696 18:22607412-22607434 CAAGTTCCTTTTATGCAGGTAGG - Intergenic
1156043564 18:32852291-32852313 AAACATCCTCTTATGATAGGAGG - Intergenic
1156842826 18:41629462-41629484 AAATTTCCTCTTATAAATGGAGG - Intergenic
1157273062 18:46291231-46291253 ACACTTCCTCTTATGACAGATGG + Intergenic
1157638612 18:49188463-49188485 AAAGTTCCTCTTAAGAATATGGG + Intronic
1160357604 18:78241278-78241300 TAACCTCCTCTTCTGAAGTTGGG - Intergenic
1167858503 19:52263300-52263322 AAACTTCCTCACATGCAAGTTGG - Intergenic
925742603 2:7019106-7019128 AAACTTCCTCTGCAGAGGGTCGG - Intronic
925930396 2:8702722-8702744 AATGTTCCTCTTAGGAATGTGGG - Intergenic
927314293 2:21664254-21664276 AAGCTTCCACTTATGACGGAAGG + Intergenic
928766855 2:34656594-34656616 CAACTACCTCCCATGAAGGTTGG - Intergenic
931874070 2:66492964-66492986 TGACTTCCCTTTATGAAGGTAGG - Intronic
932126492 2:69149775-69149797 TATCTTCCTGTTATGAATGTGGG + Intronic
933016351 2:77132187-77132209 AAAGTTGATTTTATGAAGGTAGG - Intronic
933564560 2:83934241-83934263 AAGCTTACTCTCATAAAGGTGGG + Intergenic
936741376 2:115514000-115514022 AAACTTTCTCTCATAAAGGAAGG - Intronic
938758557 2:134402601-134402623 AAACTTCCTCTCCTAGAGGTAGG + Intronic
941890004 2:170570463-170570485 AAACTGCTGCTTATAAAGGTTGG + Intronic
942736470 2:179119839-179119861 AAACTTCCACTCATGATGGAAGG - Intronic
943504030 2:188731018-188731040 ATACTTGCTTTTATAAAGGTGGG + Intergenic
946735946 2:222754650-222754672 ATACTTCCTATTATGTAAGTTGG + Intergenic
948677665 2:239608268-239608290 AAACTCCCTCTGCTGAAGTTGGG - Intergenic
1169762480 20:9111447-9111469 AAAGTTCCATTTATGAAGCTGGG + Intronic
1169838249 20:9904963-9904985 TAACAGCCTCTTTTGAAGGTAGG + Intergenic
1173441833 20:43084413-43084435 AACCTTCTTCATATGATGGTAGG + Intronic
1173734546 20:45349949-45349971 CAACTTTCTCTTATAAAGGGTGG - Intergenic
1174827836 20:53784878-53784900 AAAATTCCTCTCAGGACGGTTGG + Intergenic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1178173277 21:30067089-30067111 AGATTTCATCTTAAGAAGGTAGG - Intergenic
1181417262 22:22769641-22769663 ACTTTTCCTCTTATGAAGGAAGG - Intronic
952242575 3:31547793-31547815 AATCTTCCTAATTTGAAGGTTGG - Intronic
953320635 3:41968119-41968141 AAACTTCCTTTTTTTAAGGCCGG + Intergenic
953425551 3:42794208-42794230 GATCTTCCTCATATGAAGGAAGG + Exonic
955801772 3:62694113-62694135 AGACTTCCTCTCACGAAGGCTGG + Intronic
956053558 3:65275165-65275187 CCACTTCCTGTTATGCAGGTGGG - Intergenic
957316033 3:78578111-78578133 AATCTTTCACTTAGGAAGGTGGG + Intergenic
959078390 3:101775648-101775670 AAGCTTTATCTTATGAAGGAAGG - Intergenic
965871431 3:173269839-173269861 ACACTGCCTCTAAGGAAGGTGGG + Intergenic
966425596 3:179776507-179776529 AATCTTCTTCTTAGCAAGGTTGG + Intronic
969097875 4:4747707-4747729 AAACTTCCTCTTCTACAGGCTGG - Intergenic
973193465 4:47413267-47413289 AAACTTCTTCATATTTAGGTGGG + Intronic
974294445 4:59979002-59979024 AAACTGCCTCTAATGAAGATCGG + Intergenic
976257363 4:83112381-83112403 TGACTTCCTCTTTTGAATGTGGG + Intronic
980708581 4:136533563-136533585 AATCTTCATTTTATGATGGTTGG - Intergenic
981142562 4:141286385-141286407 AAAGTTGATCTCATGAAGGTAGG - Intergenic
987483554 5:18492309-18492331 TAACTTCAGGTTATGAAGGTAGG + Intergenic
987589933 5:19911453-19911475 AAACTTCCACATATGAATCTGGG - Intronic
990113188 5:52353706-52353728 AACCTTCACCTTGTGAAGGTTGG - Intergenic
990528186 5:56649541-56649563 AAAATTCCTTTTATCAAAGTGGG - Intergenic
995910542 5:117181780-117181802 ATACGACCTCTTGTGAAGGTAGG - Intergenic
996232719 5:121086537-121086559 AAAGTTCATCTTATAAAGGTAGG - Intergenic
997228931 5:132228779-132228801 AACCTTCCTCTCATGAATGAGGG + Intronic
998363600 5:141613150-141613172 AAACATTCTCTTATGGAGGATGG - Intronic
998555554 5:143119746-143119768 TAACTTCCTCCTCTAAAGGTGGG - Intronic
998660723 5:144234291-144234313 GAACTTTCTCTTATGAAGTGAGG - Intronic
999002009 5:147934378-147934400 GAAATTCATCTTCTGAAGGTGGG + Intergenic
1000007054 5:157195848-157195870 AAATTTCTTTTAATGAAGGTTGG + Intronic
1001719890 5:173848224-173848246 AAACTTCCTCATCTCAGGGTAGG - Intergenic
1004718681 6:18245027-18245049 TGCCTTCCTCTTATAAAGGTAGG + Intronic
1006772597 6:36566044-36566066 AAAGCTCCTCTTAAGAAGATAGG - Intergenic
1008398611 6:51037706-51037728 AATGTTCATCTTACGAAGGTAGG + Intergenic
1009819141 6:68777099-68777121 AAACTTCAAATTATGAAAGTTGG - Intronic
1009886719 6:69632030-69632052 AAACTTCATCTTAAGAAAGAAGG + Intergenic
1010764435 6:79762721-79762743 AATATTCTTCTTCTGAAGGTGGG + Intergenic
1011060761 6:83264470-83264492 ATAATTCCTCTTATGAATTTGGG + Intronic
1013482525 6:110564715-110564737 TAACTTCCTATTCTGATGGTAGG - Intergenic
1013820426 6:114147569-114147591 AAACTTCCTTTTTTGAGGGGTGG + Intronic
1020562135 7:9741688-9741710 TAACTACCTCTTGTGAAGGAAGG - Intergenic
1021349729 7:19576629-19576651 AAACTTCCGATTATGAAAGCAGG - Intergenic
1027355409 7:77349346-77349368 GCATTGCCTCTTATGAAGGTAGG - Exonic
1027652892 7:80892781-80892803 AAAATTCCTCTTTTAAAGGTTGG + Intronic
1030869815 7:114741428-114741450 AGTCTTCCTCCTATGGAGGTAGG + Intergenic
1033409256 7:141102298-141102320 AACCTTTCTCTTATGAAGAAAGG + Intronic
1037022928 8:13996250-13996272 ATACTGCATCTTATGAAGATGGG - Intergenic
1040561221 8:48524724-48524746 AATATTTCTCTTATGGAGGTTGG - Intergenic
1040611761 8:48991558-48991580 AAGATTCCTCTTATAAAGTTAGG + Intergenic
1042216481 8:66433351-66433373 TTACCTCCTCTTATAAAGGTAGG - Intronic
1043322546 8:79007768-79007790 AAACTTCCTTTTCTGATGTTGGG + Intergenic
1043595821 8:81883577-81883599 AGATTTACTCTTATAAAGGTGGG - Intergenic
1045736374 8:105300655-105300677 CTACTTTCTCTTCTGAAGGTTGG - Intronic
1047136435 8:122083959-122083981 AAATTTCCCATTATGAATGTAGG - Intergenic
1050229240 9:3501210-3501232 AAATTTTCTTTTAGGAAGGTGGG - Intronic
1050531155 9:6590571-6590593 AAACTTCCTCTCATGAAGGAAGG - Intronic
1054752404 9:68921351-68921373 AAAATTCCTCCTATGAAAGAAGG + Intronic
1058059884 9:100483912-100483934 AAACTTCCACTTATAATGATAGG + Intronic
1059477589 9:114560269-114560291 AAATTTCCCCTAATGAAGCTGGG - Intergenic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1185830482 X:3297621-3297643 AAACTTCTCATTAAGAAGGTAGG + Intergenic
1186182251 X:6984757-6984779 AAAATTCCTGTTCTGAAGGCAGG - Intergenic
1192938984 X:75893115-75893137 TTACTTCCTCTTGTGAAAGTGGG + Intergenic
1195321562 X:103725573-103725595 AAACTCCCTCTTCAGAAGCTGGG - Intronic
1196460516 X:115924368-115924390 AAACTTCCTCTTTTTAAATTTGG - Intergenic
1199088173 X:143653356-143653378 AAGCTTCCTCATATTAAGGCAGG - Intergenic
1199088221 X:143656235-143656257 AAGCTTCCTCATATTAAGGCAGG - Intergenic
1200322858 X:155207743-155207765 AACCTTCCTCTTATTCAGTTGGG + Intronic