ID: 1137416345

View in Genome Browser
Species Human (GRCh38)
Location 16:48285148-48285170
Sequence GTGGTGAGAGGACATGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137416345_1137416348 -7 Left 1137416345 16:48285148-48285170 CCTTTCGCATGTCCTCTCACCAC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1137416348 16:48285164-48285186 TCACCACTTTCTGGTCTCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 222
1137416345_1137416351 29 Left 1137416345 16:48285148-48285170 CCTTTCGCATGTCCTCTCACCAC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1137416351 16:48285200-48285222 GCCAGCTGTTAAGCTTGTGGCGG 0: 1
1: 0
2: 1
3: 11
4: 128
1137416345_1137416350 26 Left 1137416345 16:48285148-48285170 CCTTTCGCATGTCCTCTCACCAC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1137416350 16:48285197-48285219 GAAGCCAGCTGTTAAGCTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137416345 Original CRISPR GTGGTGAGAGGACATGCGAA AGG (reversed) Intronic
902619470 1:17642531-17642553 GTGGGGAGAGGGCATGGGAGGGG + Intronic
904078462 1:27857228-27857250 GTGGAAAGAGGACATGGGATGGG + Intergenic
907616523 1:55932304-55932326 GAGGTGAGAGGAGCTGTGAAAGG + Intergenic
908759533 1:67499080-67499102 GTGGTGAGATGACAGGGGCAAGG + Intergenic
909603122 1:77481238-77481260 GTTCAGAGAGGTCATGCGAAGGG - Intronic
911094046 1:94041374-94041396 GTGGTGAGTGGACATGATGATGG + Exonic
915331500 1:155115539-155115561 GTGGAGAGAGAACATGGGATTGG + Intergenic
916636698 1:166677896-166677918 GGGGAGAGAGGACATGACAAAGG - Intergenic
919739690 1:200974227-200974249 GAGGTGGGAGGAGATGGGAAGGG + Intronic
920705142 1:208244781-208244803 GCGGTGACAGGTGATGCGAATGG - Intergenic
922134160 1:222808327-222808349 GTGGAGAGAGGACATTTGCAAGG + Intergenic
922980128 1:229818628-229818650 GTGGTGAGGGGACTTAGGAAGGG - Intergenic
924511838 1:244734179-244734201 GTGCTGAGATGACAGGCGTAAGG + Intergenic
1064015573 10:11769282-11769304 GATGTGAGAGGACATTCCAAGGG + Intergenic
1064319941 10:14295625-14295647 ATGGTGAGAGGAGATGAGGAGGG + Intronic
1071711473 10:88054043-88054065 GTGGTGAGAGGACCTATGAGTGG + Intergenic
1072167219 10:92825752-92825774 GTGGAGAGAGGACATGGCCAGGG - Intergenic
1073116376 10:101094093-101094115 ATGGTGGGAGGACATGCTGAAGG - Intronic
1074147719 10:110731217-110731239 GAGGTGAGAGGAAATAAGAAAGG - Intronic
1074298747 10:112214233-112214255 GTGGAGAGAGGAAATGCGGTTGG + Intronic
1076434313 10:130429670-130429692 GTGGAGAGAGGACATGGGTAAGG + Intergenic
1078325996 11:10381195-10381217 GTGCTGAGGGGACATAAGAAGGG + Intronic
1078594933 11:12677395-12677417 GGGGAGAGAGGAAATGGGAAAGG - Intronic
1080719686 11:34837147-34837169 GGGGTGCGAGGACATGCCAAAGG - Intergenic
1081565311 11:44257275-44257297 GTGTTGAGAGGACAGGGGAAGGG - Intergenic
1083008175 11:59368296-59368318 CTGGTGAGAAGATATGGGAATGG - Intergenic
1083387109 11:62319526-62319548 GTGGTGGGAGGAAATGGGGATGG - Intergenic
1085241321 11:75058728-75058750 GTGGAGGGAGGACAAGGGAAGGG - Intergenic
1089589062 11:119529010-119529032 GGGGTGAGATGAAATGCGAGGGG - Intergenic
1091460598 12:641437-641459 GTGGGGAGAGGCCATGAGGATGG + Intronic
1091719218 12:2800492-2800514 GAGGTGAGAGGCCAGTCGAAGGG - Exonic
1095973315 12:47920862-47920884 TTAGTGAGAAGACATGGGAAAGG - Intronic
1097067056 12:56328362-56328384 GTGGGGAGAGGAAAGGCTAAGGG + Intronic
1099184725 12:79504518-79504540 TTGGTGAGAAGATATGGGAATGG - Intergenic
1099632456 12:85167811-85167833 GTGATGTCAGGACATGTGAATGG - Intronic
1103099302 12:118158614-118158636 GTGATGAGAGAACATGCTAATGG - Intronic
1103459022 12:121089215-121089237 GTGATGAGAGGAAATGCGGAGGG + Intergenic
1103957611 12:124586742-124586764 CAGGTGTGTGGACATGCGAAGGG + Intergenic
1108133320 13:47327540-47327562 ATGCTGAGTGGACATGGGAAAGG + Intergenic
1110332123 13:74284739-74284761 GTGAAGGGAGGACATGCGAGAGG + Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1112033315 13:95476058-95476080 GTGGTGATAGGACATATGAGGGG + Intronic
1112427339 13:99315061-99315083 GAAGTGAGAGGAAATGCTAAAGG - Intronic
1113325864 13:109280473-109280495 GTGATGAGAGAACATGGGACAGG + Intergenic
1113663741 13:112126250-112126272 CTGGTCAGAGGACCTGGGAAAGG - Intergenic
1115101288 14:29703873-29703895 TTTGTGAGAGGCCATGTGAAAGG - Intronic
1116864712 14:50022304-50022326 ATGGTGAAAGAACATGAGAAGGG - Intergenic
1117009716 14:51458252-51458274 GGGGTGAGAGGAGATGGGAAAGG - Intergenic
1117832562 14:59767111-59767133 GTGGGGAGAGGACTTACTAAAGG - Intronic
1119224389 14:72933823-72933845 GTGGAGAGAGGAGTTGAGAAAGG - Intronic
1120094293 14:80370455-80370477 ATTGTGAGAGGCCATGGGAAAGG - Intronic
1122300863 14:100730388-100730410 GTGGGGAGGGGACATACCAAGGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1126307206 15:47273385-47273407 GTGTTAAGAGGACCTGAGAAAGG + Intronic
1126771843 15:52064791-52064813 GGGGAGAGAGGACATGAGGAAGG + Exonic
1130099793 15:80884425-80884447 GTGGGGAGAGGAGATGGGAAAGG - Intronic
1130217206 15:81983615-81983637 GTGGTAAGAGGCAATGCGGATGG + Intergenic
1130773300 15:86946928-86946950 ATGGGCAGGGGACATGCGAAGGG - Intronic
1134019117 16:10909185-10909207 GAGGTGAGAGGAGAGGCGGATGG + Exonic
1136625010 16:31457000-31457022 GTGCTGAGAGGACTTTTGAAGGG + Intergenic
1137416345 16:48285148-48285170 GTGGTGAGAGGACATGCGAAAGG - Intronic
1138683645 16:58705882-58705904 GTGGTGAAAGGATATGTGAAAGG - Intergenic
1139357832 16:66377771-66377793 GGGCTGAGAGAACATGCTAATGG + Intronic
1139398724 16:66662662-66662684 ATGGTGGGAGGACAGGGGAAGGG - Intronic
1139657768 16:68399372-68399394 GTGGTGAGTGGACATGCTATGGG - Intronic
1140024035 16:71267399-71267421 GTGCTGAGAAGACATGCTTAGGG + Intergenic
1141117715 16:81324675-81324697 GAGGTGATAGGATATGAGAAAGG + Intronic
1142968130 17:3593572-3593594 GTGGTGATAGGACTTGTGCAAGG - Intronic
1143302093 17:5917962-5917984 ATGGTGAGAGGACATGGCCAGGG + Intronic
1147370622 17:39990151-39990173 GTGCTGAGGGGCCTTGCGAAGGG - Exonic
1149045745 17:52243268-52243290 GTGATGAGAGGAAATGGGAAAGG - Intergenic
1150160709 17:62895553-62895575 GTGGTATGAGGATATGAGAAAGG + Intergenic
1150617224 17:66781684-66781706 GGGCTGAGAGGACAGGAGAATGG + Intronic
1151212472 17:72554843-72554865 GTGCTGAGAAGACAGGAGAAGGG + Intergenic
1151219101 17:72598829-72598851 GAGGTGAGAGGGCATGCCAGTGG + Intergenic
1152390072 17:79998760-79998782 GTGGTGGGTGGATGTGCGAACGG - Intronic
1153626452 18:7025991-7026013 ATGGTGAGAGGGCAGGCGCAGGG + Exonic
1153999573 18:10472201-10472223 GAGGTGGGAGGAGATGGGAAAGG + Intronic
1156518352 18:37699876-37699898 GTGGTAAGAGAACATACAAATGG + Intergenic
1158419319 18:57278875-57278897 GTGGTGTGATGAGATGGGAAGGG - Intergenic
1159936452 18:74371958-74371980 GGGGTGAGAGGAGAGGCAAAAGG + Intergenic
1160574779 18:79846981-79847003 GTGGTAAGAAGACATGGGGAAGG + Intergenic
1164991970 19:32691470-32691492 AGGGAGAGAGGACATTCGAAGGG - Intergenic
1166238998 19:41476972-41476994 GTGGTGAGAAGATGTGGGAATGG - Intergenic
1166241287 19:41496245-41496267 GTGGTGAGAGGATGTGGGAATGG - Intergenic
1167564448 19:50247604-50247626 ATGGTGAGAGCACCTGTGAAGGG + Intronic
1167606846 19:50485771-50485793 GAGGTGAGAGGCCACGCGGAGGG - Exonic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
926225543 2:10964640-10964662 GGGGTGAGAGGAAGTGAGAAGGG - Intergenic
926780974 2:16471520-16471542 GTGGGGAGAGGACATGGTATAGG - Intergenic
926794711 2:16609413-16609435 GGGGTGAGATGACATGCCCAGGG - Intronic
930151957 2:48068515-48068537 GAGGTGAGAGGCCATGAGGAGGG + Intergenic
930265776 2:49197492-49197514 GTAGTGAGAGAACATGTAAAAGG + Intergenic
930532362 2:52605771-52605793 ATGGTGAGAGGGAATGAGAATGG - Intergenic
932498067 2:72157164-72157186 GTGGTGAAGGGATATGCCAATGG + Intergenic
935047351 2:99494054-99494076 GGGGAGAGAGCACATGCCAAGGG + Intergenic
936105862 2:109623850-109623872 GTGGGGAGAGGAAAGGAGAAGGG + Intergenic
936411297 2:112260482-112260504 CTGGTGTGAGGAGATGGGAAGGG + Intergenic
936965324 2:118122361-118122383 GAGGGGAGAGGACATGAGGATGG - Intergenic
937520987 2:122712147-122712169 CTGGTGAGAAGATATGGGAATGG - Intergenic
944539093 2:200739800-200739822 GGGGTGGGAGGACAGGCAAAGGG + Intergenic
945707677 2:213256127-213256149 GTCATGAGAGGACATTAGAATGG + Intergenic
1169484267 20:6013461-6013483 AAGGTGAGAGGGCATGGGAACGG + Intronic
1171040336 20:21756955-21756977 GCGGAGAGAGAACATGAGAAGGG - Intergenic
1171403123 20:24892216-24892238 GTTGTGAGAGGACAACAGAAGGG - Intergenic
1171879261 20:30604774-30604796 GTGGGGAGAGGACATGTAACAGG - Intergenic
1175938517 20:62526351-62526373 GTGGTGAGATGACATCCAAAAGG - Intergenic
1177212507 21:18087980-18088002 GGAGAGAGAGGACAAGCGAAGGG + Intronic
1177375074 21:20259243-20259265 GTGGTGAGAAGACAGGCCAGGGG + Intergenic
952498749 3:33939189-33939211 GAGGAGAGAGGACATGGGGATGG - Intergenic
953911450 3:46895252-46895274 GTGGTGAGAAGACAAGAGCAAGG - Intronic
957822886 3:85401114-85401136 GTGGTGAGAGGAGGAGCCAAAGG - Intronic
959158634 3:102697119-102697141 GTGGTGAGGGGACTAGGGAATGG + Intergenic
962186327 3:133263785-133263807 GCGGTGAGAGGACAAGGGATAGG + Intronic
963810425 3:149771399-149771421 TTGGTGTGAGGACAGGTGAAAGG - Intronic
967350301 3:188507308-188507330 GTGGGGAGAGGAAATGGGAGAGG + Intronic
967837011 3:193973259-193973281 GTGGTGTGAGGGCAAGAGAACGG - Intergenic
969185622 4:5472089-5472111 GAGCTGAGAGGACATGGGCAGGG + Intronic
969680441 4:8640256-8640278 GTGGTGAGAGGACATTGGGTGGG - Intergenic
970653181 4:18200319-18200341 TTGGTGACAGGACATGCAATAGG + Intergenic
970971385 4:21988175-21988197 GTGATGAGAGGCCATGAGAGTGG - Intergenic
970979715 4:22082078-22082100 GTGGTGAGAGGCAATGAGGAGGG + Intergenic
973323246 4:48831283-48831305 GTGGTGAGGGGATACGCGGAGGG - Exonic
979263227 4:118671963-118671985 GTGCTGACAGGACCTGCCAATGG + Intergenic
984342794 4:178480280-178480302 ATGATGAGAGAACATGCCAAAGG - Intergenic
988135499 5:27165573-27165595 GTGGTGGGGGGACAAGGGAAGGG - Intergenic
989732308 5:44663726-44663748 GTGGTGAGGGGAGTTGTGAAGGG - Intergenic
990328973 5:54706766-54706788 GTGGTGAGAGGAGATGGGTAGGG - Intergenic
990677309 5:58202379-58202401 GTGGTGAAGGGACAGGTGAAGGG - Intergenic
990821430 5:59844956-59844978 GTTGTGAGAGGATCTGCCAAAGG + Intronic
997749538 5:136330945-136330967 ATGGTGAGAGGTTATGGGAATGG + Intronic
997946620 5:138208423-138208445 GTGGTGAGTTGATATGAGAAGGG - Intronic
1003614823 6:7645440-7645462 GTGGAGAGAGAACAAGAGAATGG - Intergenic
1004886126 6:20053273-20053295 GTGGGAAGAGGAGATGAGAAAGG + Intergenic
1005261853 6:24069718-24069740 TTGGTTAGAGAACATGAGAAAGG - Intergenic
1005390479 6:25327958-25327980 TTGGTGAGAGGATATGGGCATGG + Intronic
1006218200 6:32464513-32464535 GTGGTGACAGGTTATGCAAAAGG - Intergenic
1006417311 6:33912343-33912365 CTGGTGAGAGGACGTGGGCAGGG + Intergenic
1006747322 6:36352467-36352489 GGGGTGAGAGGGCCTGGGAAGGG - Intergenic
1007135327 6:39515478-39515500 GTGGTCAGGGGACTTGTGAAGGG - Intronic
1010704055 6:79086877-79086899 GTGGCAAGAGGAAATGTGAAGGG - Intergenic
1011685311 6:89819260-89819282 GGGGTGAGAGGCGATGGGAAGGG + Intronic
1012000641 6:93650447-93650469 GTGGTGGGAGAACTTGAGAAAGG + Intergenic
1015859169 6:137657170-137657192 GTGATAAGAGGACATCAGAAAGG + Intergenic
1016063482 6:139654928-139654950 GTGGAGTGAGGACGTGGGAATGG + Intergenic
1017942826 6:159068157-159068179 GTGGTGTGAGGAGACCCGAATGG - Intergenic
1018964498 6:168474022-168474044 GTGGAGAGTGGAGAGGCGAATGG - Intronic
1019371466 7:664122-664144 GTGGAGAGAGGCCAGGCGAAGGG - Intronic
1019764689 7:2841970-2841992 GTGGTGAGGGGACAAGGAAAGGG + Intronic
1022414111 7:30163648-30163670 GTGGGGAGGGGACATGCCTAGGG - Intergenic
1024139010 7:46442466-46442488 GTGGCCAGAGGACATGCTAGTGG - Intergenic
1031654343 7:124333756-124333778 GTAGTGAGAGAAGATGAGAAAGG - Intergenic
1033288276 7:140061039-140061061 GTGATGAGAGGATATGTGAGAGG - Intronic
1036338256 8:7892708-7892730 GTGGTGGCAGGACATGTGCATGG + Intergenic
1036465598 8:8994111-8994133 CTGGTGAGAGTACATGGGAAAGG + Intergenic
1036752128 8:11449980-11450002 GTGGTGAGAGGAGGTGTGGAGGG - Intronic
1036972100 8:13366702-13366724 GTCCTGAGAGGGCATCCGAAAGG - Intronic
1040038121 8:42890700-42890722 GTGTTGAGAGGAAAAGGGAAGGG + Intronic
1043722669 8:83565578-83565600 GTGGTGAGGGGAGATGGGGATGG - Intergenic
1045047124 8:98289983-98290005 GTGGTAAGAGTCCATGCGAGGGG - Intronic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1048475643 8:134740088-134740110 GTGGGGAGATGAAATGAGAAGGG - Intergenic
1048747757 8:137634030-137634052 GTGGTGAGTGGAAATGGGAGTGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051285334 9:15490415-15490437 GTGGTGAGATTACAGGCGTAAGG - Intronic
1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG + Intronic
1053603293 9:39631987-39632009 GAGGTGAGAGGCCAGTCGAAGGG - Intergenic
1054250245 9:62710438-62710460 GAGGTGAGAGGCCAGTCGAAGGG + Intergenic
1054564353 9:66744966-66744988 GAGGTGAGAGGCCAGTCGAAGGG + Intergenic
1056799959 9:89684065-89684087 GGGGAGAGAGCACATGGGAAGGG + Intergenic
1057190367 9:93083903-93083925 GGGAGGAGAGGACATGCAAAGGG + Intronic
1060573775 9:124669655-124669677 CTGGTAAGAGGCCATGCTAATGG - Intronic
1060876734 9:127089278-127089300 GTGGTGAGAGGCCATGCTTCAGG + Intronic
1061256687 9:129457559-129457581 GTGGTGAGTGGATAAGTGAACGG + Intergenic
1061422647 9:130480558-130480580 GTGGTGAAAGGACGTGCCCAAGG - Intronic
1186289138 X:8077649-8077671 GTGATGAGAGGACACACAAAGGG - Intergenic
1187413489 X:19071584-19071606 GTGGTGAGAAGTCAGGAGAAGGG + Intronic
1188433430 X:30133179-30133201 GTGGTGAAAGGAGATGGGCAAGG - Intergenic
1189701095 X:43716745-43716767 GTGGTGGGGGGAGATGGGAATGG + Intronic
1191078007 X:56476375-56476397 GTAGTGAGAGGAAATGGGCACGG - Intergenic
1193137085 X:77984158-77984180 GGGGTTAGAGGACATATGAAAGG + Intronic
1193551180 X:82894510-82894532 GTTGTGAGAGAAGATGCTAAAGG + Intergenic
1194579336 X:95652537-95652559 GTTGTGAGGGGACCTGGGAAAGG + Intergenic
1199767801 X:150953609-150953631 ATGAGGAGAGGACATGGGAAGGG - Intergenic