ID: 1137426382

View in Genome Browser
Species Human (GRCh38)
Location 16:48384856-48384878
Sequence CCCGGGAGGCGGGCCCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 570}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137426382_1137426393 -9 Left 1137426382 16:48384856-48384878 CCCGGCCGGGCCCGCCTCCCGGG 0: 1
1: 0
2: 7
3: 75
4: 570
Right 1137426393 16:48384870-48384892 CCTCCCGGGCGCGCGGGGGCCGG 0: 1
1: 0
2: 8
3: 39
4: 362
1137426382_1137426394 -8 Left 1137426382 16:48384856-48384878 CCCGGCCGGGCCCGCCTCCCGGG 0: 1
1: 0
2: 7
3: 75
4: 570
Right 1137426394 16:48384871-48384893 CTCCCGGGCGCGCGGGGGCCGGG 0: 1
1: 0
2: 2
3: 47
4: 386
1137426382_1137426402 22 Left 1137426382 16:48384856-48384878 CCCGGCCGGGCCCGCCTCCCGGG 0: 1
1: 0
2: 7
3: 75
4: 570
Right 1137426402 16:48384901-48384923 CGAGGCCCTTCCCCCGCCCTCGG 0: 1
1: 0
2: 0
3: 28
4: 249
1137426382_1137426397 4 Left 1137426382 16:48384856-48384878 CCCGGCCGGGCCCGCCTCCCGGG 0: 1
1: 0
2: 7
3: 75
4: 570
Right 1137426397 16:48384883-48384905 CGGGGGCCGGGCCGCCGCCGAGG 0: 1
1: 0
2: 15
3: 85
4: 843
1137426382_1137426404 27 Left 1137426382 16:48384856-48384878 CCCGGCCGGGCCCGCCTCCCGGG 0: 1
1: 0
2: 7
3: 75
4: 570
Right 1137426404 16:48384906-48384928 CCCTTCCCCCGCCCTCGGCCCGG 0: 1
1: 0
2: 2
3: 55
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137426382 Original CRISPR CCCGGGAGGCGGGCCCGGCC GGG (reversed) Intronic
900123955 1:1061411-1061433 CCCGGGAGAGGGACCTGGCCAGG + Intergenic
900160754 1:1222364-1222386 CCCGGGTGCCGGGCCCCACCCGG + Intronic
900206940 1:1435645-1435667 TCCCGGGGGCGGGGCCGGCCTGG + Intronic
900349481 1:2227947-2227969 CGCGGGGGGCGGGGCCGGCGCGG + Intergenic
900409303 1:2505599-2505621 CCCGGGAGGCGCGGCTGACCTGG + Intergenic
900410647 1:2511021-2511043 CCCTGCAGGCTGGCCCGTCCCGG - Intronic
900489772 1:2942063-2942085 CCCGGGAGTGGGGACTGGCCTGG - Intergenic
900787063 1:4655706-4655728 CCCGGGAAGTGGGGCCGGCCAGG + Intronic
900995674 1:6122025-6122047 CCCGGGAGGTGGGCACAGCCGGG + Intronic
901045403 1:6393094-6393116 CCCCGGACGCCCGCCCGGCCGGG - Intronic
901061977 1:6475747-6475769 CCCTGGAGGCTGGCCCAGGCTGG + Intronic
901551311 1:9997710-9997732 CCGGGGAGGGGGGTCCGGCCGGG + Intronic
902078187 1:13803743-13803765 ATAGGGAGGCTGGCCCGGCCTGG - Intronic
902896954 1:19485601-19485623 CGTGGGGGGCGGGCCCGGGCCGG - Intergenic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903153251 1:21428111-21428133 CCGGGGAGCCGGGGCCGGGCGGG + Intergenic
903499838 1:23794882-23794904 CCAGGAAGGAAGGCCCGGCCAGG - Exonic
903778439 1:25807631-25807653 CCAGGAAGGCGGGCTCGGCCTGG + Intronic
903907329 1:26696280-26696302 CCCGCGAGGCCCGCCCGGGCGGG + Exonic
904037527 1:27566860-27566882 CCATGGAGGCGGGCACGGCAGGG + Intronic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
904847335 1:33430471-33430493 CCCGGGCGTCGGGCCTGACCGGG - Intronic
905033740 1:34904330-34904352 CCCGGGGGCCGGGCCAGGCAAGG - Exonic
905174283 1:36126153-36126175 CCAGGGAGGCGGGCAGGGCGCGG + Intergenic
905631466 1:39521390-39521412 CCCAGCAGGCCGGCCAGGCCAGG - Exonic
905666288 1:39764781-39764803 CCCAGCAGGCCGGCCAGGCCAGG + Exonic
906346492 1:45018734-45018756 CCTGGGATGCCGGCCAGGCCAGG + Exonic
906480935 1:46198437-46198459 GCGGGGGGGCGGGCCAGGCCGGG - Intronic
906517510 1:46448323-46448345 CCCGGGAGGCGCGGCAGGCGGGG - Intergenic
906640589 1:47438464-47438486 CCCCGACGGCGGTCCCGGCCCGG - Exonic
908714260 1:67053639-67053661 CCCGGGCAGCGGAGCCGGCCTGG - Intronic
910387971 1:86705094-86705116 CCTGGGAGATGGGCGCGGCCTGG + Intronic
910825616 1:91404516-91404538 CCCGCGAGGTGGGACCGGCTGGG - Intronic
912685197 1:111756334-111756356 CCCCGGAGCAGGGCCCTGCCGGG + Intronic
912927859 1:113929566-113929588 CCGGCGAGGCGGGGCCGGCCGGG + Intronic
914197336 1:145454429-145454451 CCGGGGCGGCGGGGCCGGCGGGG - Intergenic
914753440 1:150550378-150550400 CCCGGGGCCCGGGCCAGGCCTGG - Intronic
914942735 1:152037066-152037088 CCCGGGAGGCGGGGAGGGGCGGG - Intronic
915490591 1:156248059-156248081 CCAGGCAGGCGGGCCAGGCCTGG + Intronic
915600509 1:156920485-156920507 CCCGAGGGGCGGGCCAGGCCCGG - Intergenic
916694470 1:167221539-167221561 CCCCGGGAGCGGGCCCGGGCGGG + Intronic
917909760 1:179631314-179631336 CCCGGGAGGCGGAGCTTGCCGGG + Intronic
922526713 1:226309454-226309476 GCCGGGAGCGGGGCCCGGGCGGG - Exonic
922840212 1:228641709-228641731 CCCAAGAGCCCGGCCCGGCCCGG + Intergenic
922840772 1:228643950-228643972 CCCAAGAGCCCGGCCCGGCCCGG + Intergenic
923126654 1:231039868-231039890 CCGGGACGGCGAGCCCGGCCGGG + Intronic
923783021 1:237042487-237042509 CTCGGGAGCCGGCCCCGGCGAGG + Exonic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
1063504084 10:6580389-6580411 CCCGGGAGGCCGGGCTGGCGGGG - Intergenic
1065114989 10:22476415-22476437 CCCGCGTCGCTGGCCCGGCCTGG - Intergenic
1065342835 10:24723218-24723240 GCCGGGCGCCGGGCCCGGCCGGG + Intronic
1066367476 10:34791410-34791432 CTGGGGAGGAGGCCCCGGCCTGG - Intronic
1066406863 10:35126929-35126951 CCCGGGAGGCCGTCCCGGCGTGG + Intronic
1067416483 10:46106661-46106683 CCCGGAAGGCGTGTGCGGCCAGG + Intergenic
1068544136 10:58327257-58327279 CCCGGGACGCGGTCCTGGCCTGG + Intergenic
1068560823 10:58512917-58512939 CCCGGGTCGCGGCCCCGGTCCGG - Intergenic
1069755698 10:70773339-70773361 CCCGGGAAGTGGGACCAGCCTGG - Intronic
1070111652 10:73492983-73493005 CCAGGGAGGCAGGCCGGGCGCGG + Intronic
1071336135 10:84601698-84601720 CCCGGGAGGCGCTGCCTGCCAGG + Intergenic
1071546953 10:86536438-86536460 GCCGGGACACTGGCCCGGCCGGG - Intergenic
1071573841 10:86711847-86711869 GCGGAGAGCCGGGCCCGGCCCGG + Intronic
1071618107 10:87094712-87094734 CCAGGGCAGCGGGCCCGGCCCGG + Exonic
1072637201 10:97185729-97185751 ACCTGGAGGCGGCCCCGGACGGG - Exonic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1072926501 10:99621042-99621064 GGCGTGAGGCGGGGCCGGCCTGG + Intergenic
1073063605 10:100745977-100745999 CCGGGGCGGTGGGCCGGGCCGGG - Exonic
1073196197 10:101694326-101694348 CCCGGGACGCGGGGCCGGCTCGG + Intronic
1075733375 10:124649462-124649484 GCCTGGAGGTGGGGCCGGCCAGG - Intronic
1075801852 10:125159416-125159438 GCCGGGCGGCGGGCGCGGGCGGG - Intronic
1076189094 10:128470333-128470355 GCTGCCAGGCGGGCCCGGCCTGG + Intergenic
1076523485 10:131095311-131095333 CCCGAGAGGCGGGCAGGGCTGGG + Intronic
1077226051 11:1439593-1439615 CCCAGGAGGTGGGCATGGCCGGG + Intronic
1077249168 11:1553173-1553195 CCCTGGAGGCAGCCCCAGCCCGG - Intergenic
1077322242 11:1947591-1947613 CCCAGGGGGCGGGCGTGGCCGGG + Intronic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1077533527 11:3108179-3108201 CCAAGGAGGCAGACCCGGCCTGG + Intronic
1077582197 11:3423476-3423498 CCCGGGAGTCGGGGCCGGTTAGG + Intergenic
1077635867 11:3840995-3841017 CCGGCGAGGCGGGGCGGGCCGGG + Intergenic
1078190851 11:9091635-9091657 CTCGGGGGGCGGGCGGGGCCGGG - Intronic
1079237044 11:18698661-18698683 CCCGGCTGGCGGCGCCGGCCAGG - Intronic
1079294604 11:19221738-19221760 CCCGGGGGGCTGGCCCAGGCTGG + Intergenic
1079308565 11:19345359-19345381 GCCCGGCGGCGGGACCGGCCTGG + Intergenic
1079430955 11:20387849-20387871 TCCGGGACACGGGCCCGGGCAGG + Intronic
1079459953 11:20670217-20670239 TCCGGCTGGCGGGCGCGGCCGGG + Intronic
1079773698 11:24497023-24497045 CCGGCGAGGCGAGCCCTGCCGGG - Intronic
1080387324 11:31817779-31817801 CCCGGGCTCCGGCCCCGGCCCGG - Intronic
1080592511 11:33736242-33736264 CTCGGGAGGCTCGCCCGGCAGGG + Intronic
1081699983 11:45146825-45146847 CCCGGGCGGCGAGAGCGGCCCGG - Intronic
1081720704 11:45286256-45286278 GCCTGGAGGCGGGCCCGGCCCGG - Exonic
1083182560 11:60996540-60996562 CTCGGGAGGCGGGCCCACCAGGG + Intronic
1083572589 11:63768441-63768463 CCCGGGCGGGGGCCCCGGCGTGG - Intronic
1083610180 11:64000649-64000671 TCCGGGAGGCGGGGGCCGCCGGG + Intronic
1083614599 11:64019974-64019996 GCAGGGAGGCTGGCCCTGCCTGG - Intronic
1083647613 11:64181774-64181796 CCTGGGAGGAGGGCCCTGGCCGG + Intergenic
1083735062 11:64675473-64675495 CCTGGGAGGCTGGGCAGGCCAGG + Intronic
1083883191 11:65558292-65558314 CGCGGGAGAGGAGCCCGGCCAGG - Intronic
1083899759 11:65638042-65638064 GCCGGGAGGCGGGGCCGGCCGGG - Intronic
1084010922 11:66347814-66347836 CCCGGGAAGCCGGCGGGGCCCGG - Intergenic
1084165186 11:67372275-67372297 CCCGGGGGGAGGGCCAGGCTGGG + Intronic
1084239119 11:67806293-67806315 CCCGGGAGGCGGGGCCGGTTAGG + Intergenic
1084310436 11:68313169-68313191 GCGCGGAGGCGGGCCTGGCCCGG + Intronic
1084517005 11:69642728-69642750 CCCGGGACCCTGGCCCGCCCTGG - Intronic
1084716846 11:70879703-70879725 CCTGGGAGGGGGGCCCCGCATGG - Intronic
1085666682 11:78420332-78420354 CCTGAGAGGCGTGCCAGGCCTGG + Intergenic
1086455505 11:86955596-86955618 GCCGGGAGGCGGGCGGGGCGGGG - Intergenic
1087795665 11:102452816-102452838 CCGGGGCGGCGGGGCCGGGCTGG + Exonic
1089208867 11:116787728-116787750 CCAGCCAGGTGGGCCCGGCCGGG - Intronic
1089575596 11:119440692-119440714 CCCGGGAGGCGGAGCTGGCAGGG - Intergenic
1089579100 11:119470420-119470442 CCCAGGAGGCAGGGCTGGCCTGG + Intergenic
1089720789 11:120419015-120419037 CCTGGGAGGCGGGTCCAGCCTGG - Intronic
1089720796 11:120419033-120419055 CCTGGGAGGCGGGTCCAACCTGG - Intronic
1089747516 11:120627604-120627626 CCCAGGAGGCAGGCCCTGCTGGG + Intronic
1090832327 11:130428184-130428206 CCCCGGCTGCGGGCCGGGCCGGG + Exonic
1091278733 11:134370121-134370143 CCAGGGAGGAAGGCCAGGCCTGG - Intronic
1091286641 11:134411987-134412009 CCGGGGCGGCGGGGCCGGGCGGG - Intergenic
1202805260 11_KI270721v1_random:2904-2926 CCCAGGGGGCGGGCGTGGCCGGG + Intergenic
1091434145 12:460296-460318 CCTGGGCGCGGGGCCCGGCCGGG + Intergenic
1091762453 12:3096041-3096063 CCCGGGCGGCGCTCCCGGCGCGG + Intronic
1092147341 12:6223708-6223730 GCGGGGAGGCGGGCCCTGCTGGG - Intronic
1092169408 12:6363795-6363817 CCCGGGAGGCCGGTCCATCCCGG + Intronic
1092230639 12:6773745-6773767 CCCAGGAGGAGGGCGCCGCCGGG - Exonic
1092335478 12:7629056-7629078 ACAGGGAGGCGGCCCGGGCCGGG - Intergenic
1092409805 12:8243922-8243944 CCCGGGAGGCGGGGCCAGTTAGG + Intergenic
1092446689 12:8564524-8564546 ACAGGGAGGCGGCCCGGGCCGGG + Intergenic
1095773638 12:45990102-45990124 CCCGCGAGGGAGGCTCGGCCCGG - Intronic
1095938002 12:47705841-47705863 CCGGTGAGGCGGGGCGGGCCGGG - Intronic
1095947036 12:47759258-47759280 GCCGGGAAGCGGCCCCAGCCCGG - Intronic
1096468876 12:51864151-51864173 CCCGGGAGGAGGGCCACGCCTGG + Intergenic
1096496992 12:52044344-52044366 CCCGGCAAGCGGGGCAGGCCAGG - Intronic
1096840972 12:54379099-54379121 CCGGGGTGGCGGACCCGGGCTGG + Intronic
1097155100 12:57006545-57006567 GCCGGGCGGCGGGGGCGGCCCGG - Intergenic
1097173043 12:57128199-57128221 CCAGGGAGGAGGGCCCAGCCAGG + Intronic
1097284207 12:57865273-57865295 TCCGGGCTGGGGGCCCGGCCTGG + Intergenic
1097288723 12:57896698-57896720 CCCGGGCGGCGGGCTGGGCCCGG - Intergenic
1097794026 12:63843860-63843882 CCCGCGAGCCTGGCCCCGCCTGG + Intergenic
1098105997 12:67069399-67069421 GCCGGGAGGCCGGGCCGGGCCGG + Intergenic
1100483615 12:95003685-95003707 CCCGGGAGGCGGGGCCAGCGAGG - Exonic
1101640382 12:106582609-106582631 GCCGGGAGGGGGGCGCGGGCGGG - Intronic
1102101517 12:110281756-110281778 GACGGGAGGCGAGGCCGGCCGGG + Exonic
1102457171 12:113077964-113077986 CCCGGGAGGCGGCGCGGGCTCGG - Exonic
1102518980 12:113467539-113467561 CCCCCGAGGCGGGGCCGGGCCGG + Intronic
1103276028 12:119712543-119712565 CCCTGGAGGTGGGCCGGGCTTGG - Intronic
1103363918 12:120369052-120369074 CCGGGGAGGCGAGGCCGGGCTGG + Exonic
1103541994 12:121672619-121672641 CGCGCGCCGCGGGCCCGGCCGGG + Intronic
1103562820 12:121800952-121800974 TCTGGCAGGCGGGCCCAGCCGGG - Intronic
1103626868 12:122226378-122226400 GGCGGGAGGCGGGGCCGGGCGGG + Exonic
1103917936 12:124385519-124385541 CCTTGGAGACGGGCCGGGCCAGG - Intronic
1104761246 12:131298729-131298751 CCCCGGAGGCGATGCCGGCCCGG - Intergenic
1104818529 12:131662063-131662085 CCCCGGAGGCGATGCCGGCCCGG + Intergenic
1104857403 12:131908555-131908577 TCCGTGTGGCGGGACCGGCCTGG + Intronic
1104857470 12:131908830-131908852 GCAGGCAGGCGGGCCCGGCGGGG + Intronic
1104887441 12:132118950-132118972 GCCGGGAGGCTGCCCCAGCCGGG + Intronic
1104961518 12:132490419-132490441 GGCGGGCGGCGGGCCGGGCCGGG - Exonic
1106517166 13:30465403-30465425 CCGGGGCGGCGGGGCCGGCGCGG - Intronic
1107373272 13:39775133-39775155 CTCGGGAGCCAGGCCTGGCCTGG + Intronic
1108373312 13:49792180-49792202 CCCGTCACGCGGGCGCGGCCTGG - Intronic
1108541714 13:51452376-51452398 CCCGGGCGGCGACCCCGGCCCGG - Intronic
1110318643 13:74135705-74135727 CACGCGGGGCGGGCCGGGCCGGG - Intergenic
1110705949 13:78602197-78602219 CCCGGGCGGCGGCGGCGGCCCGG - Exonic
1110705957 13:78602215-78602237 CCCGGGGGGCGGTGGCGGCCCGG - Exonic
1110860622 13:80341482-80341504 CTCGGGCGGCAGGACCGGCCTGG - Intergenic
1112050707 13:95642052-95642074 CCCGGGAGGCGGCCCAGGCTGGG - Exonic
1113693596 13:112329096-112329118 CCCAGCAGGATGGCCCGGCCAGG - Intergenic
1114674238 14:24430206-24430228 CGCGGTGGGCGGGCCCGGCCCGG + Intronic
1114674241 14:24430219-24430241 CCCAGGGGCCGGGCCGGGCCGGG - Intronic
1115688915 14:35824704-35824726 TCCGGGAGGCTGGCCTGGCGGGG + Intergenic
1115855053 14:37622233-37622255 CGCGCGGGGCGGGCCGGGCCGGG - Intronic
1118366599 14:65102113-65102135 CCCAGGAGGCCGCTCCGGCCAGG + Intronic
1118752345 14:68816419-68816441 CCCGGGCCCCGCGCCCGGCCCGG - Intergenic
1119438216 14:74611673-74611695 CCCGTGGAGCGGGCCCAGCCGGG - Exonic
1120993376 14:90397597-90397619 CCTGGGAGCCGGGCGGGGCCGGG + Intronic
1121439327 14:93939021-93939043 CATGGGAGGCGGGCGGGGCCGGG - Intronic
1121645760 14:95516438-95516460 CTGGGGAGGCGCGCCCGGCGCGG - Intronic
1122124885 14:99573570-99573592 CCAGTGAGGCAGACCCGGCCTGG + Intronic
1122162337 14:99793444-99793466 GCCGGGGAGCGGGCGCGGCCCGG + Exonic
1122718124 14:103707366-103707388 GCAGGGAGGGGGGCCCAGCCGGG + Intronic
1122719064 14:103712153-103712175 CCCGTGAGGCGGGCAGGGCAGGG + Intronic
1122904866 14:104796999-104797021 CCCTGGAGGTGGGCCCTTCCTGG - Intergenic
1122922598 14:104886150-104886172 CGGGGGAGTCGGGCCAGGCCGGG + Intronic
1122924891 14:104894967-104894989 ACAGGGAGGCTGGCCTGGCCAGG - Exonic
1123053582 14:105559313-105559335 CCCGGGAGCCGGCTCGGGCCTGG - Intergenic
1123078160 14:105679728-105679750 CCCGGGAGCCGGCTCGGGCCTGG - Intergenic
1125284026 15:38073056-38073078 CCCGGGCGCGCGGCCCGGCCTGG + Intergenic
1125541229 15:40471142-40471164 CCTGGAAGGCGGGCTCGGGCTGG - Exonic
1125577941 15:40767787-40767809 CCTGGGAGGGGCGCCAGGCCTGG + Exonic
1125589145 15:40843932-40843954 GCCGCGGGGCGGGCCGGGCCTGG + Intergenic
1126406926 15:48331631-48331653 GCCGAGGGGCGGGCCTGGCCCGG - Exonic
1126738038 15:51751566-51751588 CCCCGGCGCCGCGCCCGGCCGGG + Exonic
1127117668 15:55743446-55743468 CCCCGGAGGCTGGCTGGGCCAGG - Intergenic
1127224926 15:56918734-56918756 CCCGGGAGGAAGGGGCGGCCAGG + Exonic
1128069120 15:64783031-64783053 CCCGGGAGGCTGGCTCTACCGGG + Intergenic
1128795986 15:70467008-70467030 CCCGGGGGGAAGGCCAGGCCTGG - Intergenic
1128841350 15:70853849-70853871 CCCGGGAGGTGGGCCCCGAGGGG - Intronic
1129264440 15:74386398-74386420 GCCGGGAGGCGAGACAGGCCAGG - Intergenic
1129299155 15:74615625-74615647 GGCGGGAGGCGGGCCGGGCCAGG + Exonic
1130076581 15:80695250-80695272 GGCAGGAGGCGGGGCCGGCCCGG - Intronic
1130296093 15:82647812-82647834 GCCGGGACGCGGCCCCGCCCAGG + Intronic
1130991613 15:88879130-88879152 CCTGGGAGGAGGGCCTGGACTGG - Exonic
1131060160 15:89399717-89399739 CGAGGGCGGCGGGCCAGGCCCGG + Intergenic
1131180050 15:90233511-90233533 GCCGGGAGGAGGGCGCAGCCCGG + Intronic
1131466048 15:92655584-92655606 CGCGGGCGGCGGGAGCGGCCAGG + Exonic
1131827416 15:96332188-96332210 GCCGGGCGGCGGGCCGGGCACGG - Exonic
1132028473 15:98421740-98421762 GCCAGGAGGCGGGCGCGCCCCGG + Intergenic
1132055325 15:98647720-98647742 CCCGGAAGGGGGGCCCAGACAGG - Intergenic
1132499876 16:280555-280577 CGCGGGGGGCGCTCCCGGCCGGG + Intronic
1132544762 16:528036-528058 CCCGTCGGCCGGGCCCGGCCGGG + Intronic
1132592319 16:731402-731424 CCCGCCAGGAGGGCCCTGCCTGG + Intronic
1132616097 16:841854-841876 CCCGGGAGGAAGGCTCTGCCCGG - Intergenic
1132626182 16:892697-892719 CCAGGAAGGAGGGGCCGGCCCGG + Intronic
1132641534 16:980678-980700 CCCGCGAGGTGGCCTCGGCCCGG - Intronic
1132648788 16:1011114-1011136 CCAGGGAGGCTTGCCCGGGCGGG - Intergenic
1132684724 16:1157565-1157587 CCGGGGAGGCGGGCGCAGGCGGG - Intronic
1132698761 16:1213382-1213404 CCAGGGGGGCGGGCCCTGCCAGG + Intronic
1132741422 16:1414940-1414962 CCCGGGACGCTGGTCCTGCCCGG + Intergenic
1132771311 16:1565014-1565036 CCCGTGAGGTGAGACCGGCCTGG + Intronic
1132815811 16:1826190-1826212 CCCGGGGCGCTGGCCTGGCCCGG + Intronic
1132889245 16:2196090-2196112 CCCGGGAGGCGGGTGCCGCCAGG + Intronic
1132899430 16:2245133-2245155 CCAGGGAGGCGGGCTCGGGGAGG + Intronic
1133097681 16:3458314-3458336 CCGGGGGCGCGGGCGCGGCCGGG - Intronic
1133232104 16:4371793-4371815 CCCGGGGGGCGGGCCCGCCGCGG - Intronic
1133350782 16:5098705-5098727 ACCGGGAGGCGGGGCCGGTTAGG + Intergenic
1133597190 16:7304140-7304162 CCAGGGAGGAGGGACCGGCGGGG + Intronic
1134115168 16:11542710-11542732 CCCAGGTCGCTGGCCCGGCCTGG - Intergenic
1134190782 16:12119684-12119706 CCCAGGAGCCGGGCTGGGCCTGG + Intronic
1134471809 16:14532729-14532751 CCCGGGAGGGGCGGCTGGCCGGG + Intronic
1134644960 16:15858349-15858371 CCCGGGGAGGGGGACCGGCCCGG - Intergenic
1135135834 16:19884934-19884956 GCCCGGGGGCGGGGCCGGCCGGG - Intronic
1136003559 16:27313829-27313851 CCCGCCCGGCGCGCCCGGCCCGG - Intronic
1136129607 16:28211662-28211684 CGCGGGGGTCGGGCCCGGGCGGG - Exonic
1136453912 16:30369998-30370020 CCGGGGAGGCGCGGCCCGCCTGG - Exonic
1136590337 16:31214635-31214657 GCGGGGCGGCGGGCCCGGCCTGG + Intronic
1137252086 16:46747963-46747985 CCCGGGCACCGGGCCCGGGCGGG - Exonic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1137617947 16:49858010-49858032 CCCGGGAGGGGGGCGAGGTCGGG - Intergenic
1139402905 16:66696533-66696555 CGCGCGAGGCGGCCCGGGCCGGG - Exonic
1139448620 16:67013889-67013911 CCCAGGTGGGCGGCCCGGCCCGG - Intergenic
1140223123 16:73058214-73058236 CCGGGGAGGAGGGGGCGGCCCGG + Intronic
1141184699 16:81779179-81779201 TCCGAGAGGCGGACCCGGCTGGG + Intronic
1141531317 16:84648689-84648711 CCAGGAAGCCGCGCCCGGCCGGG + Intronic
1141665308 16:85462718-85462740 GGCGGGAGGCGGCGCCGGCCGGG + Intergenic
1141957895 16:87384432-87384454 CCGGGGATGCGCGCCCGGTCTGG + Intronic
1141989971 16:87603830-87603852 CCAGGGCCGCGGGCCCAGCCTGG - Intronic
1142182757 16:88679213-88679235 TGCGGGAGGCTGGCCTGGCCAGG - Intronic
1142192189 16:88723134-88723156 CCCAGGAGGTGGTCCCAGCCAGG - Exonic
1142268233 16:89075218-89075240 CCTGGGAGGAGGGGCTGGCCTGG - Intergenic
1142670578 17:1485848-1485870 CGCGGGAGGCGGGGGAGGCCGGG - Intronic
1142876298 17:2853653-2853675 CGCGGGAGGCGGGGCCGGGGCGG + Intronic
1143116495 17:4584473-4584495 CCGGGGAGGCGGGCGCGGGGCGG - Intronic
1143376010 17:6468161-6468183 TCCGGGAGGTGGGGCTGGCCCGG - Intronic
1143484018 17:7243105-7243127 CCGGGGAGGCGGGGCCGGCTGGG + Intronic
1143503547 17:7352073-7352095 CCCGCGAGGCTCGCGCGGCCCGG - Intronic
1143554140 17:7650464-7650486 GCCGGGAGGCTGGCCGAGCCAGG - Intronic
1143747272 17:9003594-9003616 CCCGGGGCGCGGGCGCGGCAGGG - Intergenic
1144498932 17:15768987-15769009 CCCGGGGTGCCGGCCAGGCCAGG + Intergenic
1144586671 17:16491704-16491726 CGCGGGGGGCGCGCCGGGCCAGG - Intronic
1144586784 17:16492066-16492088 CCCGGGAGGCGAGCGCGCACGGG - Intronic
1144724799 17:17496476-17496498 CGGGGGAGGCGGGCCCCGCGGGG - Intergenic
1144891057 17:18494611-18494633 CCCAGAAGGCGGGCACAGCCAGG + Exonic
1145141166 17:20449707-20449729 CCCAGAAGGCGGGCACAGCCAGG - Intronic
1145162313 17:20584022-20584044 CCCGGGGTGCCGGCCAGGCCAGG + Intergenic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1145794758 17:27649226-27649248 CCCAGGAGGCAGGCACAGCCAGG + Exonic
1145846342 17:28042015-28042037 CCCGGGAGGCGGGCGGGGTACGG - Intronic
1145963815 17:28902941-28902963 GCCGGGAGGCGCGGCCGGCATGG - Exonic
1146053328 17:29568725-29568747 GCTGGGCGGCGGGCCGGGCCCGG + Exonic
1147168646 17:38605823-38605845 CCGGGGGCGCGGGCCCCGCCGGG + Exonic
1147339547 17:39745513-39745535 CCCTGGAGGAGGCCCAGGCCTGG + Exonic
1148555809 17:48578006-48578028 TCCGGGAGGAGGGCCCCGGCGGG + Exonic
1150133317 17:62680722-62680744 CCCCGGAGGCGGGCGCGGCAGGG - Intronic
1150373662 17:64662367-64662389 GACGGGAGGCGGGGCCGGCGGGG + Intergenic
1150983442 17:70169309-70169331 CCGGGGAGTCGGGCCCGGGCCGG - Intronic
1151662431 17:75525847-75525869 CCGAGGGGGCGGGCCCGGCTGGG - Intronic
1151719584 17:75847646-75847668 CCCGGGAGGGGGCCGCAGCCGGG - Intronic
1151938897 17:77281021-77281043 CGGGCGGGGCGGGCCCGGCCAGG - Intronic
1151954391 17:77373270-77373292 CCCGGGAGGCGGGGGCGGGGCGG + Intronic
1151970176 17:77453742-77453764 CCCAGGAGGCTGGCCAGGGCTGG - Intronic
1152356380 17:79809695-79809717 CCCTGGAGGCGCGGGCGGCCTGG - Intergenic
1152706525 17:81846392-81846414 CCCGGGAGGCAGCCCTGGCCCGG + Intronic
1152725101 17:81941281-81941303 GCCCTGACGCGGGCCCGGCCCGG - Exonic
1152729165 17:81961386-81961408 CGCCGGAGGCGCTCCCGGCCCGG + Intronic
1152852677 17:82647431-82647453 CGCGGGAGGCGGGCGGGACCTGG - Intronic
1153320703 18:3771449-3771471 CCCCGGAGACGCGCTCGGCCCGG + Intronic
1153997504 18:10454752-10454774 GCCGGGACGCGGACCGGGCCGGG + Exonic
1154210787 18:12377148-12377170 CTCGGGAAGCGGGCTCGGCTCGG + Exonic
1155504368 18:26518340-26518362 CCCAGGAGGCAGACCCAGCCTGG - Intronic
1157464202 18:47930530-47930552 CCCGGGCCGCCGGCCGGGCCCGG - Exonic
1157609681 18:48948798-48948820 CCTGGGGGGCGGGCCGGGGCGGG - Intronic
1158435809 18:57435257-57435279 CCCGGGAGGCGGGCCTTCCACGG - Intergenic
1159113546 18:64088045-64088067 CCCGGGAGGCGGAGCTTGCCGGG + Intergenic
1160040009 18:75336957-75336979 CCCTGGGGCCGGGCCAGGCCTGG + Intergenic
1160146739 18:76371544-76371566 CTCCGGACGCAGGCCCGGCCAGG - Exonic
1160693472 19:471004-471026 CCTGTGAGACGGGCCAGGCCCGG + Intronic
1160706623 19:532848-532870 TCCGGGACGCGGGCCCGAGCCGG - Intronic
1160719315 19:590382-590404 GCGAGGAGGCGGGCCCGGCGGGG + Exonic
1160888006 19:1360949-1360971 GGAGGGAGGCGGGCCCAGCCTGG - Exonic
1160937753 19:1605255-1605277 TCCGGGGGCCGGGCCGGGCCGGG - Intronic
1160943375 19:1630247-1630269 CCCGGCAGGGGGGCGGGGCCAGG + Intronic
1160993133 19:1869080-1869102 CCCTGGATGGGGGCCGGGCCAGG + Intergenic
1161062870 19:2223663-2223685 CCCGGGAGGCCGGCCCTGCCCGG - Intronic
1161087324 19:2341098-2341120 CCCTGGAGGCCGCCCCAGCCTGG + Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161175826 19:2841718-2841740 CGCGGGAGGCGGGGCCGGGCGGG - Intronic
1161203649 19:3029231-3029253 CGCGGGCGGCGGGCCCCGCGCGG + Intronic
1161346412 19:3770766-3770788 CCCAGGAGGCGGGGGAGGCCTGG + Exonic
1161400624 19:4065290-4065312 CCCGGGTGGGGGGCCTGGCCTGG - Intronic
1161438795 19:4279273-4279295 CCCGGGACGCGGCCCGGGGCTGG + Exonic
1161482626 19:4518455-4518477 CCCTGGAGGACGGACCGGCCCGG + Intergenic
1161672932 19:5624091-5624113 CCCGGGAGGCGGGCAGAGCCTGG + Intronic
1162027481 19:7902907-7902929 CCCGGGAGGTGGCCAGGGCCAGG - Intergenic
1162808268 19:13150190-13150212 GCCGGGAGGGGGGTTCGGCCTGG - Exonic
1162940452 19:14006065-14006087 CCGGGGTGGCTGGCCGGGCCGGG - Intronic
1163633790 19:18429400-18429422 CCCGGGCGGCGCGCCCTCCCCGG - Intronic
1163657838 19:18557986-18558008 CCCGGGGGCCGCGCCCGACCCGG - Intronic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1164179758 19:22807829-22807851 CCCGCTAGGAGGGCCCGTCCTGG - Intergenic
1164249560 19:23465230-23465252 CCCGGGAGGCGGAGCCTGCAGGG + Intergenic
1164575840 19:29404871-29404893 CCTGGGAGGCAGGTCCGGCCTGG + Intergenic
1164776238 19:30855759-30855781 CCCTGGCCGCGGGCCCAGCCAGG - Intergenic
1164840265 19:31387878-31387900 CCTGGGAGACAGGCCCAGCCCGG + Intergenic
1164958443 19:32406089-32406111 GCCGGGACGCGGGCCGGGCTGGG + Intronic
1165311351 19:35030868-35030890 CGCGGGGGGCGCGCGCGGCCGGG + Intronic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1165448222 19:35868478-35868500 CCAGGAAGGCGGGGCCGGCGCGG + Exonic
1165939865 19:39409708-39409730 CGCGGGAGGCGGGAGGGGCCGGG + Intergenic
1166079341 19:40434029-40434051 CCCGGGAGGCGGCCGCGGCCGGG - Intergenic
1166121628 19:40690490-40690512 CGCGGGAGGCGGGGGCGCCCGGG - Exonic
1166226246 19:41397414-41397436 CCCAGGAGGATGGCCCAGCCCGG - Exonic
1166329544 19:42070097-42070119 GCAGGGAGGCAGGCCCAGCCGGG - Intronic
1166546929 19:43639599-43639621 CCCGGGGAGGGGGCCCGGCCCGG + Intronic
1166765773 19:45251555-45251577 CCCGGGGGGCAGGGGCGGCCGGG - Exonic
1166984139 19:46649565-46649587 GCCGGGGGGCGGGCCAGCCCCGG - Exonic
1167071728 19:47226130-47226152 CCCGGGCGCCGGGGCGGGCCGGG - Intronic
1167258004 19:48442688-48442710 CCCGGGAGCCGGCCGCGGCGCGG - Exonic
1167284097 19:48589116-48589138 CCCGAGAGGCGGCGCTGGCCGGG + Intronic
1167297784 19:48661995-48662017 CCGAGGCGGCGGGCCCGGCATGG - Exonic
1167551393 19:50163225-50163247 CCTGGGAGGCGGGGCGGGCCGGG - Intergenic
1167558470 19:50210470-50210492 CGCGGGTGGCGGGCCTGGCTCGG + Exonic
1167903364 19:52638400-52638422 CCCGCGAGGTGGGCGGGGCCTGG + Intronic
1167943056 19:52962922-52962944 CCCGAGAGGTGGGCGGGGCCTGG + Intergenic
1168057961 19:53873995-53874017 GCCTGGACCCGGGCCCGGCCCGG + Exonic
1168688390 19:58362277-58362299 GCTGGGAGGCGAGCCCAGCCTGG + Intronic
924962502 2:46694-46716 CCAGGGAGGCGGGCCCGGGCGGG - Intronic
925350494 2:3197886-3197908 CTGGTGAGGCGGGCCTGGCCAGG + Intronic
926012967 2:9423205-9423227 CCCGGGAGCGCGGCCCCGCCCGG + Exonic
926112991 2:10194604-10194626 CCCGGGTGGCTTGGCCGGCCTGG + Intronic
926136790 2:10342304-10342326 CCCTGGAGGCGGGCGAGGCAGGG - Intronic
927714037 2:25341410-25341432 CCCGGAAGGCGGGGGCGGCCCGG + Intronic
928093976 2:28392980-28393002 CGGGCGAGGCGGGCCCGTCCGGG + Exonic
928518281 2:32063938-32063960 CTCGGGCGGAGGGGCCGGCCCGG - Exonic
928683691 2:33727519-33727541 ACCTGGACCCGGGCCCGGCCCGG - Intergenic
929604753 2:43226809-43226831 CCCGGGCCGCCGGCCCCGCCCGG - Intergenic
929614790 2:43298015-43298037 CCGGGGCGGCTGGCCGGGCCGGG - Intronic
930030857 2:47057217-47057239 CCCTGGAGGCTGGCCCTGCTGGG + Intronic
931566809 2:63622893-63622915 CGCGGGGGCCGGGCCAGGCCGGG + Intronic
932201230 2:69829960-69829982 CCAGGGCGGGGGGCTCGGCCCGG + Exonic
932334559 2:70922645-70922667 GCCGGGAGGAGGGGCAGGCCGGG + Intronic
932773230 2:74513290-74513312 CCCGGGGGCCGGGGCGGGCCGGG + Intergenic
932780123 2:74554332-74554354 GGCTGGGGGCGGGCCCGGCCAGG + Exonic
934031859 2:88055592-88055614 CCCCGGCGGCGGGGGCGGCCCGG - Intronic
934539112 2:95159742-95159764 CTCGGGAGGCGGGGCTGGCGCGG - Intronic
934933201 2:98445082-98445104 CCAGGTAGGTGGGCCGGGCCGGG + Exonic
936349573 2:111702621-111702643 CCGGGGAGGGGAGCCTGGCCTGG - Intergenic
936412941 2:112276202-112276224 TCGGGGAGGCGGGCGCGGCCGGG - Intronic
937112445 2:119377092-119377114 CCTGGCAGGCTGGCCTGGCCTGG + Intergenic
937215107 2:120307686-120307708 CCCGGGAGCCTGGCCCTGTCGGG - Intergenic
937325044 2:120985319-120985341 CCAGGCAGGTGGGCCCGGACAGG + Intronic
938073130 2:128318732-128318754 CCGGGGAGCCGGGGCCGGGCGGG - Intergenic
938310871 2:130287418-130287440 CCCAGGGGGCGCGCCCGGCAGGG + Intergenic
938343363 2:130549656-130549678 CCCGCCAGGAGGGCCCAGCCAGG - Intronic
938346470 2:130571066-130571088 CCCGCCAGGAGGGCCCAGCCAGG + Intronic
938909877 2:135876219-135876241 CTCCGGAGGCGGGCGAGGCCCGG + Intronic
941384923 2:164841346-164841368 CCCGGGAGGCGGGCCGGCCGGGG - Exonic
941905181 2:170713058-170713080 CCAGGGAGGCGGGCAGGGCCGGG - Exonic
942799733 2:179861422-179861444 CCCGCTGGGCGCGCCCGGCCCGG + Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
943033858 2:182716414-182716436 CCCTGGCGGCGGACCCCGCCTGG - Exonic
943725190 2:191245539-191245561 TCCGGGACGCGGGCCCAGCCCGG - Exonic
945081004 2:206085862-206085884 CCGGGGATGTGGGCCGGGCCTGG + Intronic
945955469 2:216082181-216082203 CCCGGCAGGCGGGCGCAGCGAGG - Exonic
946248395 2:218399731-218399753 ACTGGGAGGCGGGCCGGGCCGGG - Intronic
946397272 2:219449243-219449265 CAGGGGAGGTGGGCCGGGCCCGG - Exonic
946921292 2:224584755-224584777 CCCGGGAGGGCGGCCGCGCCGGG + Intronic
947447518 2:230175584-230175606 CCCTGGAGGCTGGCCTGACCAGG - Intronic
947592953 2:231395648-231395670 CGCGGGAGGAGGGGCCGGCAGGG - Exonic
947761142 2:232604728-232604750 CCCTGGAGGCGGGGTCGGCTGGG - Intergenic
948190532 2:236054864-236054886 CCGGGGAGGGGGCCCGGGCCCGG - Intronic
948207170 2:236168426-236168448 CACGTGAGGCGAGCCGGGCCAGG - Intergenic
948466050 2:238152115-238152137 GTCAGGAGTCGGGCCCGGCCAGG + Exonic
948492203 2:238320792-238320814 GCCGGGGACCGGGCCCGGCCAGG + Intronic
948598120 2:239093394-239093416 CCCAGGAGGCTGGCCCCTCCTGG + Intronic
948633686 2:239319440-239319462 CCCGGGAGGTGGCCCTCGCCTGG - Intronic
949023438 2:241753910-241753932 CCGGGGAGGAGGGCAGGGCCAGG + Intronic
1169211518 20:3768351-3768373 CCCGGGTGCCTGGCCCGGCCTGG + Intronic
1169214784 20:3786637-3786659 CCCCGGAGGTGCCCCCGGCCCGG - Exonic
1170606941 20:17881888-17881910 CCCATGAGGCTGGCCCTGCCTGG + Intergenic
1172138204 20:32702332-32702354 CCCGGGAGGCGGAGCCTGCAGGG + Intergenic
1172991519 20:39040381-39040403 CCAGGGAGTGGGGCCCGGCCTGG + Intergenic
1173804142 20:45912883-45912905 CCCGGGAGGCGGGGCTTGCAGGG - Intergenic
1173896488 20:46554899-46554921 CCCGGGAGGTGGACCTGGACAGG + Intergenic
1174287802 20:49484365-49484387 CCCGGCAGGCTGGGCCGGGCAGG - Intergenic
1174352989 20:49981705-49981727 CCTGGGAGGCGTACCAGGCCCGG - Intergenic
1175074048 20:56358949-56358971 CCCGGGAGGCGGGCGGAGGCCGG - Exonic
1175133837 20:56808532-56808554 CCCGGGAGGCAGGCTGGCCCTGG - Intergenic
1175399579 20:58692845-58692867 GCCGAGCGGCGGGCCGGGCCGGG + Exonic
1175874535 20:62223102-62223124 CCCGGCAGGCTGGTCCGGGCTGG + Intergenic
1175999556 20:62825832-62825854 CCCGGGAGGCCGGCGGGCCCAGG - Exonic
1176113808 20:63422464-63422486 CCCAGGAGGAGGGCCGGGGCGGG + Intronic
1176178547 20:63739563-63739585 CTAGGGAGGGAGGCCCGGCCCGG - Intronic
1176194925 20:63832365-63832387 CGAGGGAGTCGAGCCCGGCCCGG + Intergenic
1176207233 20:63895535-63895557 TGCGGGAGCCGGGCCGGGCCGGG + Intronic
1176549096 21:8213791-8213813 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176556989 21:8258012-8258034 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176568028 21:8396829-8396851 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176575931 21:8441049-8441071 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1179787429 21:43737745-43737767 CCAGGGAGTCTGGCCCGGCCTGG - Intronic
1179940621 21:44637137-44637159 CCCGGGAGACAGGCTCAGCCAGG + Intronic
1180051864 21:45335234-45335256 CCCGGGAGGGGGCACAGGCCTGG - Intergenic
1180078983 21:45477795-45477817 CCTGGGGGGCCTGCCCGGCCAGG - Exonic
1180190875 21:46161887-46161909 CCCGTGGGGAGGGCGCGGCCAGG - Intronic
1180731417 22:17985202-17985224 CACGGGAGGAAGGTCCGGCCAGG + Intronic
1181051827 22:20241599-20241621 CCCGTGGGGCAGGCCAGGCCAGG - Exonic
1181085494 22:20437716-20437738 CCCGGGGGGCCGGGCCGGCGCGG - Exonic
1181107301 22:20582782-20582804 CCCTCGAGGCTGGCCCTGCCTGG + Intronic
1181811179 22:25404874-25404896 GCCCGGAGGCGGGCCTGGCCCGG - Intronic
1182222918 22:28772931-28772953 CCCGGCGGGAAGGCCCGGCCGGG - Exonic
1182236971 22:28883726-28883748 CGCGGAGGGCGGGCGCGGCCGGG - Exonic
1182532321 22:30969670-30969692 CCGGGGAGGCGGGGGTGGCCGGG + Intergenic
1183170044 22:36180999-36181021 CCCGGGAGGCGGGCTTGGCTAGG + Intergenic
1183903391 22:41022358-41022380 CCCGGGACGCGAGCGCGGCGGGG - Intergenic
1183942137 22:41301903-41301925 CCCGGCGCGCGGCCCCGGCCTGG - Intronic
1184091774 22:42296636-42296658 GCCGGGAGGCAGGCCAGGCAGGG + Intronic
1184171749 22:42764256-42764278 CCAGTGAGGCTGGCCGGGCCCGG - Intergenic
1184184712 22:42857009-42857031 CTTGGGAGGCGGGGCCGGCGCGG - Intronic
1184458877 22:44626081-44626103 CCCGGGAGGAAGGCCCAGCGGGG - Intergenic
1184495621 22:44839567-44839589 ACAGGGAGGCAAGCCCGGCCTGG - Intronic
1184523780 22:45009799-45009821 CCCGGGCTGCCGGCGCGGCCCGG + Intronic
1185053090 22:48563857-48563879 ACCTGGAGGCGGGCTGGGCCAGG - Intronic
1185271140 22:49929723-49929745 CCCGGGAGCCGGGCCGAGCAGGG - Intergenic
1185278620 22:49960653-49960675 CCCGCGAGGCGGCGGCGGCCGGG - Exonic
1185289093 22:50015107-50015129 CCCGTGAGTCGGGACCGGCGCGG - Exonic
1185398576 22:50604656-50604678 CCCGGGCGGGCGGCGCGGCCGGG - Exonic
1185400332 22:50612318-50612340 CCTGGGAGGCGGGCTCACCCAGG - Intronic
1185413486 22:50697735-50697757 GCGGGGGGGCGGGCCCGGCGCGG + Intergenic
1203253981 22_KI270733v1_random:130107-130129 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203262037 22_KI270733v1_random:175186-175208 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950023771 3:9806976-9806998 GGCAGGAGGAGGGCCCGGCCAGG - Intronic
950192423 3:10986859-10986881 CCCAGGAGGCTGGCACTGCCCGG + Intergenic
950570341 3:13795976-13795998 GCCGAGAGCCAGGCCCGGCCAGG - Intergenic
951611325 3:24495099-24495121 CCCGGGAAGCGGGCCGGGGCGGG - Intronic
951981855 3:28575529-28575551 CCCCGGAGGCGCGCTCGGCCGGG + Intergenic
952867214 3:37862065-37862087 GCCGGGCGGCGGGCGCGCCCAGG + Intronic
953464400 3:43106048-43106070 CCCGGCGGGCGAGCCCGGCGCGG + Exonic
953614395 3:44477483-44477505 CCCGGGCGGCGGACGGGGCCCGG - Intronic
953748587 3:45593635-45593657 GCCGGGCGGCGGGCACAGCCTGG + Intronic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
954246935 3:49339691-49339713 CCTAGGGGGCGGGCCCGGCGGGG - Intronic
957055047 3:75436051-75436073 CCCGGGAGGCGGGGCCAGTTAGG + Intergenic
961299796 3:125915622-125915644 CCCGGGAGGTGGGGCCGGTTAGG - Intergenic
961755121 3:129122457-129122479 CCGGGCAGGCGGACCAGGCCTGG - Intronic
962301877 3:134250605-134250627 CCCGGGAGGCAACTCCGGCCCGG + Exonic
963091515 3:141487324-141487346 CCCGGGAGGGGGCCTGGGCCGGG + Intronic
964422021 3:156513134-156513156 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
966015074 3:175131791-175131813 CCCGGACGGGGGGCCTGGCCGGG + Intronic
966096808 3:176213682-176213704 CCGGGGCGGCGGGGCCGGCAGGG + Intergenic
966874562 3:184314848-184314870 CCCAGCAGCCAGGCCCGGCCGGG - Intronic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
967058015 3:185847312-185847334 CCCGGGAGGCGGAGCCAGCCTGG - Intergenic
967867747 3:194204194-194204216 CCCGAGACGCGGCCCGGGCCCGG + Intergenic
968473538 4:792403-792425 TCCCGCAGGCGGGGCCGGCCCGG + Intronic
968512893 4:1003185-1003207 CCCGGGACCCCGGCCCGGCCCGG - Intronic
968551411 4:1225596-1225618 CCCGGAGGCTGGGCCCGGCCCGG - Intronic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968628148 4:1637340-1637362 CCGGGGAGGTGGGGACGGCCTGG - Intronic
968671729 4:1855830-1855852 GCCGGGAGCCGGCCCCGCCCTGG + Intronic
968729425 4:2262613-2262635 CCCGGCGGCCCGGCCCGGCCCGG - Intergenic
968909855 4:3472166-3472188 CCGGGGAGGTGGGCACGGCTGGG + Intronic
968997860 4:3956358-3956380 CCCGGGAGGCGGGGCCGGTTAGG + Intergenic
969115260 4:4867223-4867245 GCCGGGAGGTGAGCCCAGCCGGG + Intergenic
969632607 4:8347164-8347186 CCTGGTAGGTGGGCCAGGCCTGG + Intergenic
969714813 4:8863368-8863390 CCAGGGAGGCGGGAGAGGCCGGG - Intronic
969756138 4:9152297-9152319 CCCGGGAGGCGGGGCCAGTTAGG - Intergenic
969816463 4:9691462-9691484 CCCGGGAGGCGGGGCCGGTTAGG - Intergenic
970332510 4:15001870-15001892 CGCGGGAGCCCGGCCCAGCCCGG - Intergenic
972484247 4:39527247-39527269 CCCGGGCGGCGGGGCCAGCCTGG + Intronic
972725844 4:41746037-41746059 CCCGGGAGGCGAACCCGGCAAGG - Exonic
975666735 4:76740877-76740899 CCCGAGTGGCGGGACAGGCCCGG + Exonic
976595654 4:86892502-86892524 CCCGGGAGACGCGCCCCGCGGGG + Intronic
978576721 4:110196790-110196812 CCCAGGAGGCGGGCTCCGCCCGG + Intronic
979622585 4:122812535-122812557 ACCGGGCGGCTGGCCGGGCCGGG - Intergenic
979820627 4:125166160-125166182 CACAGGAGGTGGGCCCGGCACGG + Intergenic
982026039 4:151254920-151254942 CCCGGGAGGGGCGGCTGGCCAGG + Intronic
982349597 4:154400225-154400247 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
984992579 4:185396073-185396095 CCCGGGAGGAGAGCCCGGCGTGG + Intronic
985660727 5:1155563-1155585 CCCGGGGGTCGGTCCCTGCCTGG - Intergenic
985791570 5:1931067-1931089 GCCTGGAGGCGGGCTCGCCCCGG + Intergenic
987006373 5:13714456-13714478 CCCGGGAGGCGGTGGTGGCCCGG - Exonic
988482202 5:31639753-31639775 CCCGGGATGCGCGCCCGAGCAGG - Intronic
992105853 5:73448438-73448460 CCCGGGCGGCAGGCCCGGCCGGG + Intergenic
995853990 5:116574147-116574169 CCCGGGAGGTGGGGCGCGCCCGG + Intronic
996698372 5:126423444-126423466 CCCGGGAGCTTGGCGCGGCCCGG + Intronic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
1001902720 5:175444727-175444749 CCCAGGTGGCGGGCGCGTCCCGG + Intergenic
1001906608 5:175478646-175478668 CGCGGGCGGCAGGCCCAGCCAGG + Intronic
1002134326 5:177098583-177098605 CCCGGGAGACTGGCCAGGGCGGG - Intergenic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002211160 5:177600148-177600170 CCCGGGAGGCCGGGCCGGCCGGG + Exonic
1002541164 5:179907523-179907545 CCCGGGAGCCGGGCGCGGAGGGG - Intronic
1002591021 5:180291820-180291842 CCCGGCGGGCGGGCTAGGCCTGG - Intronic
1002640249 5:180627303-180627325 CCCGGGGGGAGTGCCTGGCCTGG + Intronic
1002645123 5:180649175-180649197 CCTCGGAGCCGGGCCCTGCCGGG - Intronic
1002662779 5:180802850-180802872 CCCGGCAGGCGGGGCGGGGCGGG + Intronic
1002784502 6:391611-391633 GCCGAGAGCCGGGGCCGGCCGGG - Intergenic
1002888049 6:1312905-1312927 TGCGGGAGGCGGGCCGGGCGCGG + Exonic
1004562092 6:16760918-16760940 CCCGGGCGGGGGGCGCGGGCGGG - Intronic
1005002500 6:21256668-21256690 CCTGGGAGGCGGCTCCAGCCTGG + Intergenic
1006642775 6:35497283-35497305 CCCGGGAGCGGGGCGAGGCCCGG - Intergenic
1006787541 6:36678653-36678675 TCCTTGAGGCGGGCCCGGGCGGG + Intronic
1007665189 6:43509611-43509633 CCAGGGACGTGGCCCCGGCCAGG + Exonic
1010428253 6:75749476-75749498 CCCGGGAGCAAGGCCGGGCCAGG - Intronic
1010791565 6:80070644-80070666 GCCGGGCGCCGGGCCCGGCCGGG + Intergenic
1012550878 6:100464234-100464256 CCTGGGACGTGCGCCCGGCCTGG - Intronic
1015064959 6:129013359-129013381 CCCGGGAGGCGGAGCCTGCAGGG + Intronic
1015149232 6:130019869-130019891 CGCGGGCCGCGGGCCGGGCCGGG + Intronic
1016936420 6:149451686-149451708 CCCGGGAGGCGCGGGCGGCCTGG + Intronic
1017004603 6:150020764-150020786 CCCAGGAGGAGGGCCCGACGAGG + Intronic
1017497778 6:154996050-154996072 CCCAGGAGCCGCGCCCGTCCGGG - Intronic
1018940993 6:168308770-168308792 TCCTCGAGGCTGGCCCGGCCAGG - Exonic
1019334186 7:475273-475295 CCCGGGGGACGGCCCCGCCCTGG + Intergenic
1019457610 7:1138533-1138555 CCCGGGACGCCAGCCCGGCCGGG - Intergenic
1019486430 7:1291485-1291507 CCTGGGATGTGGGCCAGGCCAGG - Intergenic
1019598240 7:1868399-1868421 CCCGGGAGGCGCGGCCTGCGTGG - Intronic
1019932965 7:4235839-4235861 CCCTGGCTGCGGGCCTGGCCCGG - Intronic
1020073057 7:5240176-5240198 CAAGGGAGGCAGGCCGGGCCAGG + Intergenic
1020107366 7:5428295-5428317 CCCGGGACACGAGACCGGCCCGG - Intergenic
1021106543 7:16645426-16645448 CCCGGGGGGCGCTCCTGGCCTGG - Intronic
1022020869 7:26398529-26398551 GCCGGGAGGGGGAGCCGGCCCGG - Intergenic
1022094403 7:27130073-27130095 CGCGGGAGGTGGGCCGGGGCTGG - Intronic
1023722793 7:43113122-43113144 CCGGGGATGCCGGCCCGGACCGG - Intronic
1023722802 7:43113140-43113162 CCCGGGTGGCGACCCCGGCTTGG + Intronic
1023834522 7:44060434-44060456 GCAGGGAGGTGGGCCAGGCCTGG + Intronic
1023863959 7:44230050-44230072 CCTGGGAGGGGGGCCCAGCCTGG - Intronic
1023990348 7:45124893-45124915 CCTGGGAGGTGGGCCCAGCAAGG - Intergenic
1024255444 7:47537125-47537147 GCGGGGAGCCGGGCTCGGCCGGG + Intronic
1024556209 7:50605293-50605315 CCCTGGAGGAGGGCCACGCCTGG - Exonic
1026909445 7:74083852-74083874 TCCGAGAGGCGCCCCCGGCCCGG + Intronic
1027421137 7:78019426-78019448 CGGGGGTCGCGGGCCCGGCCGGG + Exonic
1029111732 7:98216194-98216216 GGCGAGAGGCTGGCCCGGCCCGG - Exonic
1029123216 7:98281768-98281790 CCGGAGCGGCGGGCGCGGCCGGG + Exonic
1029176705 7:98669809-98669831 CCTGGGAGGAGGGCCAGGCATGG + Intergenic
1029259793 7:99294069-99294091 CGAGGGAGGCGGCCCGGGCCTGG - Intergenic
1029525758 7:101092640-101092662 CCCGGAAGGCGCGGCTGGCCGGG - Intergenic
1029570330 7:101364065-101364087 CCCGGGCGCCGGGACCCGCCAGG + Intronic
1029640465 7:101816540-101816562 GCCGGGAGGGGGCCGCGGCCCGG + Intronic
1029715069 7:102321315-102321337 CCGGGGACGCGGGCGCGGCAGGG - Exonic
1030270010 7:107660886-107660908 CCCGGGAGTGGAGCCCGGGCCGG - Intronic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1031468629 7:122144001-122144023 GCCGCGAGGCGACCCCGGCCGGG - Intronic
1034234268 7:149554988-149555010 CCCGGCCGGCCGGCCCGTCCGGG + Intergenic
1034243116 7:149624623-149624645 ACCGGGAGGCGGGCCCTGCGTGG - Intergenic
1034439983 7:151081453-151081475 CCGGAGAGGCGGGCCTGGGCAGG + Exonic
1034445985 7:151114694-151114716 CCCCGGCCGCGGCCCCGGCCCGG + Intronic
1034560253 7:151875819-151875841 CCCGGGCGGCTGGCGCGGACGGG + Intronic
1034958431 7:155350241-155350263 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958445 7:155350277-155350299 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958471 7:155350349-155350371 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958486 7:155350385-155350407 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958502 7:155350421-155350443 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958517 7:155350457-155350479 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958531 7:155350493-155350515 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958547 7:155350529-155350551 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958561 7:155350565-155350587 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958577 7:155350601-155350623 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958591 7:155350637-155350659 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958607 7:155350673-155350695 GCCGGGAGGGGAGGCCGGCCCGG - Intergenic
1034958621 7:155350709-155350731 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1034958636 7:155350745-155350767 GCCGGGAGGGGAGGCCGGCCGGG - Intergenic
1035287591 7:157816239-157816261 CCAGGGAGGCGGGGCAGGCACGG - Intronic
1035302833 7:157908199-157908221 CCATGGTGCCGGGCCCGGCCTGG + Intronic
1035710352 8:1708817-1708839 CCCGGGAGGTGGACCAGTCCAGG + Intergenic
1035747865 8:1974407-1974429 CCCGGGAGGAGCCCCCGCCCTGG - Intronic
1036656345 8:10679736-10679758 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1036656361 8:10679792-10679814 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1036733300 8:11284770-11284792 CCCGTGGGGCGGGGCGGGCCGGG - Exonic
1036850175 8:12195011-12195033 CCCGGGAGGCGGGGCCAGTTAGG + Intergenic
1036871538 8:12437284-12437306 CCCGGGAGGCGGGGCCAGTTAGG + Intergenic
1037803841 8:22048952-22048974 CGCGGGAGGCGGGCGCGTCCAGG + Intergenic
1037884401 8:22588814-22588836 CCTGGGAGTCAGGGCCGGCCAGG - Intronic
1037909884 8:22738029-22738051 CTCAGGAGGCTGGCCCTGCCAGG - Intronic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1039531778 8:38269081-38269103 CCTGGGAAGCGGGGCCGCCCGGG + Intronic
1040081360 8:43289313-43289335 CCAGGGAGGTGGGCGAGGCCAGG + Intergenic
1041270296 8:56104301-56104323 ACGGGGAGGCTGGCCCGGCGGGG + Intergenic
1044832375 8:96262284-96262306 GCGGGGAGGGGGGCCCGGCATGG + Intronic
1045443632 8:102239066-102239088 CGGGGGAGGCGGGGCCGGGCCGG - Exonic
1048844498 8:138594079-138594101 CCCATGGGGCCGGCCCGGCCTGG + Exonic
1049442145 8:142614421-142614443 CCGGGGAGGCAGGTCCGGCTCGG + Exonic
1049471613 8:142777369-142777391 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471648 8:142777474-142777496 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471667 8:142777526-142777548 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049471686 8:142777578-142777600 CCCAGGAGGCGGGTCCGGGGCGG - Intronic
1049585398 8:143430491-143430513 CGCGGGCGGCGGTCCCGGCGGGG + Intergenic
1049651000 8:143769664-143769686 CCAGGCAGGTGGGCCTGGCCTGG - Intergenic
1049726200 8:144147659-144147681 CCGGGGACGCGGGCTCGGCGCGG - Intergenic
1049786787 8:144454730-144454752 GCTGGGAGGCCGGCCCTGCCTGG + Intronic
1049815376 8:144596707-144596729 CCCGGGTGGCGCGCACTGCCGGG + Intronic
1049891482 9:73837-73859 CCAGGGAGACGGGACGGGCCTGG - Intergenic
1053149312 9:35732610-35732632 CCTGGGAGGCGGGTCCGGAGAGG + Exonic
1053163601 9:35829585-35829607 GCCGGGATGGGGGCCAGGCCAGG - Exonic
1053441203 9:38117810-38117832 CCCTGGAGAGGGGCCAGGCCTGG + Intergenic
1054175051 9:61869181-61869203 GCCGGGGGCCGGGGCCGGCCTGG + Intergenic
1054662486 9:67711612-67711634 GCCGGGGGCCGGGGCCGGCCTGG - Intergenic
1056643435 9:88389053-88389075 CCGGGGACGCGGGCCTGCCCTGG + Intronic
1057077767 9:92147845-92147867 CCCGAGAGGCGGGCAGGGCTGGG + Intergenic
1057234334 9:93346554-93346576 CGGGAGAGGCGAGCCCGGCCGGG - Intergenic
1057239772 9:93398656-93398678 CCAGGGAGCCGGGCACGGGCAGG + Intergenic
1057869736 9:98708782-98708804 GCGGGGCGGCGGGCCGGGCCAGG - Exonic
1058801650 9:108550273-108550295 CCCAGGAGGCTGGCCAGTCCTGG - Intergenic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1061044955 9:128160068-128160090 CCCGGGAGAGGGGCGAGGCCGGG + Intergenic
1061546548 9:131308038-131308060 CGCGGCTGGCGTGCCCGGCCGGG - Exonic
1061583984 9:131554764-131554786 CCCAGGCGGCGGGCGAGGCCGGG + Intergenic
1061838647 9:133345141-133345163 CCAGGGTGGAGGGCACGGCCTGG - Intronic
1061926385 9:133808041-133808063 CCCGGGTGGCGGCCCCAGGCTGG + Intronic
1061991953 9:134163948-134163970 CTCGGGAGACGGGCCCTGTCGGG + Intergenic
1062092037 9:134683360-134683382 CTGGGGAGGAGGGCCAGGCCAGG + Intronic
1062364651 9:136203007-136203029 GCGGGGAGCTGGGCCCGGCCCGG - Exonic
1062393291 9:136342539-136342561 GCCGGGCGGCGGCCCCAGCCAGG - Intronic
1062423959 9:136497579-136497601 CCGGTGAGGGGGGCCAGGCCAGG + Intronic
1062596423 9:137301941-137301963 CGCGGGCCGCGGGCCGGGCCGGG + Exonic
1062596502 9:137302160-137302182 CGCGGGGGCCGGGCCCGGCCGGG + Exonic
1062696346 9:137877996-137878018 CCGGGGCGGCGGGGCCGGCGGGG + Exonic
1203470382 Un_GL000220v1:113251-113273 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203478203 Un_GL000220v1:157223-157245 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185472522 X:392925-392947 CCCGGGAGGCGGCTCCAACCTGG - Intergenic
1187281462 X:17860978-17861000 CCCGGGCGCCGGGCCCCGCCAGG + Intronic
1187281467 X:17860992-17861014 CCCGCCAGGCGCGCCCAGCCCGG + Intronic
1187384050 X:18831409-18831431 CCCGGGATGGGGGCCGGGCGCGG + Intergenic
1187698227 X:21941291-21941313 CCCGCGCGGCGAGCCCGGGCTGG + Intronic
1189262663 X:39689266-39689288 CCGGGGACGCGGGGGCGGCCCGG - Intergenic
1189988699 X:46575211-46575233 CCCGGGAGGCGGTGCACGCCTGG + Exonic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1192166375 X:68829768-68829790 CCCGGGAAGATGGCTCGGCCTGG + Exonic
1194714588 X:97275290-97275312 CCCGGGAGGGGCGGCTGGCCCGG + Intronic
1196965198 X:121047720-121047742 CCAGGGCAGCGGGCCCGGCCCGG - Exonic
1200089576 X:153628008-153628030 CCCGGGAGGCTGGGACTGCCAGG + Intergenic
1200162786 X:154017974-154017996 CCTGGGAAGCGTGCCGGGCCAGG + Intronic