ID: 1137426659

View in Genome Browser
Species Human (GRCh38)
Location 16:48385733-48385755
Sequence CCGGGGCCGCGTGACCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137426650_1137426659 15 Left 1137426650 16:48385695-48385717 CCGTCGGCTCAGGGCAGCTCCTC 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
1137426649_1137426659 16 Left 1137426649 16:48385694-48385716 CCCGTCGGCTCAGGGCAGCTCCT 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
1137426652_1137426659 -4 Left 1137426652 16:48385714-48385736 CCTCCCGCGGCGCTTTGTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
1137426656_1137426659 -7 Left 1137426656 16:48385717-48385739 CCCGCGGCGCTTTGTTCCGGGGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
1137426657_1137426659 -8 Left 1137426657 16:48385718-48385740 CCGCGGCGCTTTGTTCCGGGGCC 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137426659 Original CRISPR CCGGGGCCGCGTGACCCCCC CGG Intronic