ID: 1137427565

View in Genome Browser
Species Human (GRCh38)
Location 16:48392401-48392423
Sequence ATGGCTCATGGCCCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137427565_1137427572 10 Left 1137427565 16:48392401-48392423 CCCAGAAAGGGGCCATGAGCCAT 0: 1
1: 0
2: 3
3: 15
4: 160
Right 1137427572 16:48392434-48392456 AGGCCTCTAGAAAACTGAAAAGG 0: 1
1: 0
2: 2
3: 46
4: 295
1137427565_1137427574 15 Left 1137427565 16:48392401-48392423 CCCAGAAAGGGGCCATGAGCCAT 0: 1
1: 0
2: 3
3: 15
4: 160
Right 1137427574 16:48392439-48392461 TCTAGAAAACTGAAAAGGCAAGG 0: 1
1: 2
2: 14
3: 108
4: 850
1137427565_1137427570 -10 Left 1137427565 16:48392401-48392423 CCCAGAAAGGGGCCATGAGCCAT 0: 1
1: 0
2: 3
3: 15
4: 160
Right 1137427570 16:48392414-48392436 CATGAGCCATGGAATGCAGGAGG 0: 3
1: 39
2: 141
3: 291
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137427565 Original CRISPR ATGGCTCATGGCCCCTTTCT GGG (reversed) Intronic
900512503 1:3067304-3067326 ATTGCTCATGGCCCTTCTCTAGG + Intergenic
900531417 1:3155257-3155279 GGGGCCCATGGCTCCTTTCTTGG + Intronic
901396206 1:8983873-8983895 ATGACTCATGACACGTTTCTTGG + Intergenic
902717187 1:18280883-18280905 AGGGCTCAGGGTCCCCTTCTGGG + Intronic
903138997 1:21327305-21327327 GTGGCTCATGCAACCTTTCTGGG + Intronic
905494616 1:38375046-38375068 ATAAGTCATGGCCCCTGTCTTGG - Intergenic
907356901 1:53882976-53882998 ATGACACATGGCCTCTTCCTTGG - Intronic
909172604 1:72315429-72315451 ATGGCTCTTGTCCTCTTACTGGG - Intergenic
909625486 1:77711236-77711258 ACTGCTCCTGGCCCCTTTGTGGG - Intronic
910631102 1:89355131-89355153 CTTGATCATGGCCCCTTCCTGGG + Intergenic
910641204 1:89464411-89464433 CTTGGTCATGGCCCCTTCCTGGG - Intergenic
911702650 1:100972102-100972124 CTGGCTCCTGGTCCCATTCTAGG + Intronic
913061422 1:115211880-115211902 ATGCCTCATGGACCTTTCCTTGG - Intergenic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
915737708 1:158095197-158095219 ATTGCTCATTGCTCCCTTCTCGG + Exonic
916306190 1:163336101-163336123 ATGGATCATGTCCTTTTTCTTGG + Intronic
918755710 1:188337772-188337794 ATGGCTCTTGGCCCGTTACTGGG - Intergenic
920122569 1:203669724-203669746 ACCGTTCCTGGCCCCTTTCTGGG + Intronic
920440585 1:205978225-205978247 ATGGCTCATTCCTCCTTGCTGGG - Exonic
922066191 1:222145936-222145958 ATGGCTTCTGCCCCCTTTCCAGG - Intergenic
924729174 1:246696457-246696479 ATGGATCATTGTCCATTTCTTGG + Intergenic
1066064477 10:31752154-31752176 CTGTCTCCTGGCCCCTTTATTGG + Intergenic
1067570683 10:47368869-47368891 ATATCTCATGGCTCCTTGCTGGG - Exonic
1070321593 10:75358790-75358812 ATGGCGCATGTCCCCATTCCCGG + Intergenic
1073332776 10:102681542-102681564 ACTGCTCATGGCCCCTTTTGTGG + Intronic
1074569204 10:114609095-114609117 ATGGCTCATGTCAGCTTTTTAGG + Intronic
1075557277 10:123442762-123442784 TTGGCTCAGGTCCTCTTTCTGGG - Intergenic
1075838792 10:125479498-125479520 ATGCCTCACCTCCCCTTTCTGGG + Intergenic
1078456297 11:11478348-11478370 ATTTCCCATGGCCTCTTTCTTGG + Intronic
1080399700 11:31922425-31922447 ATGTCTCATGGCCCCTCCCTTGG + Intronic
1083775059 11:64890559-64890581 CTGGCTCAGGGCCCCATCCTGGG + Intergenic
1084600087 11:70140129-70140151 GTGGCTCAAGACCCCTTTCTGGG - Intronic
1090550999 11:127819873-127819895 ATTGATTATGTCCCCTTTCTTGG - Intergenic
1091262691 11:134246459-134246481 AGGGATCAAGGCCCCTTCCTGGG - Exonic
1091912078 12:4240763-4240785 GTTGCCCATGGCCCCTGTCTTGG + Intergenic
1094830055 12:34296032-34296054 AAGACTCAGGACCCCTTTCTCGG - Intergenic
1094843430 12:34351351-34351373 AGGGTTCTTGGCCCCTTCCTCGG - Intergenic
1097167016 12:57091448-57091470 ATTGCTCATGCTCCCTTTCCGGG - Exonic
1097836102 12:64274121-64274143 AGGCCTCAGGGCCCCTTCCTGGG - Intronic
1098431038 12:70420471-70420493 TTGGCTCATGGCCCCCTCCCTGG - Intronic
1103578900 12:121899736-121899758 GCGGCTCATGGCCTCTTTGTGGG - Exonic
1103737890 12:123071942-123071964 ATGGCTGAAGTCCCCTTTCCAGG - Intronic
1104425767 12:128676995-128677017 ATGGCCCTTGGCCCTTCTCTAGG - Intronic
1104888984 12:132130675-132130697 ATGGCTCCCAGCCCCCTTCTTGG - Intronic
1104895571 12:132162092-132162114 ATGGCTCATGACACCTGCCTCGG + Intergenic
1105242968 13:18624074-18624096 AAGGCCCATTGCCCTTTTCTGGG + Intergenic
1108242090 13:48475439-48475461 ATGGCTATTGGCCCCTCTATTGG + Intronic
1111056061 13:82952763-82952785 ATGGCTTCAGGCCCCTTTCCAGG - Intergenic
1112133809 13:96553197-96553219 CTGGCTTATAGCCCCTTCCTAGG + Intronic
1113587854 13:111477365-111477387 TTCTCCCATGGCCCCTTTCTAGG - Intergenic
1117214314 14:53534878-53534900 CTGGGTCATGGACCCTTTCATGG - Intergenic
1119044622 14:71307776-71307798 ATGGCTGATGGCAGCTCTCTTGG + Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1128577620 15:68787059-68787081 ATGGCTTGTTGCCCCTTTTTGGG - Intronic
1128601486 15:68998837-68998859 ATGGTTCATGGCCCCATGATGGG - Intronic
1129821402 15:78604485-78604507 TTGGCTGATGGCTCATTTCTGGG + Intronic
1133173918 16:3999451-3999473 ATGGCTCTGGCCCCCTTTCCTGG + Intronic
1133832122 16:9332970-9332992 TTGGCTCATGGCCCCTTCCTTGG + Intergenic
1137427565 16:48392401-48392423 ATGGCTCATGGCCCCTTTCTGGG - Intronic
1139382330 16:66540860-66540882 GTGGCTCATGGCCACTGTATTGG - Intronic
1144629175 17:16861662-16861684 CTGGCCCATGGCTCCTTTCTCGG - Intergenic
1148955467 17:51350348-51350370 GTTGCTGTTGGCCCCTTTCTGGG - Intergenic
1150172597 17:63015088-63015110 ATGGCTCATGGCTTATTTTTGGG + Intronic
1151336860 17:73444891-73444913 GTGGCTCATGGCCCCTGCATTGG - Intronic
1153881771 18:9427479-9427501 TTGGCCCATGGCCCCTTCCTTGG + Intergenic
1154026256 18:10710018-10710040 ATGAATCAGTGCCCCTTTCTGGG + Intronic
1154445971 18:14435823-14435845 AAGGCCCATTGCCCTTTTCTGGG - Intergenic
1158570870 18:58596135-58596157 TTTGCTCATTCCCCCTTTCTGGG - Intronic
1159914025 18:74173120-74173142 ATGGCTTAGAGCCCCTTTCTGGG - Intergenic
1161848750 19:6727710-6727732 TTGGCTCGTGGCCCCTTTCTTGG + Intronic
1164570653 19:29372159-29372181 ATGGCACAGGGCTCCATTCTCGG + Intergenic
1167332197 19:48862997-48863019 ATGGCTCATTGCCACCTTCCTGG - Intronic
1167758597 19:51428806-51428828 CGGGCTCATGGCCCATTTCTTGG - Intergenic
925879719 2:8342203-8342225 TTGGCTCATGGTCCCTTCCTCGG - Intergenic
927470614 2:23373290-23373312 TTGGCTCTTGGCTCCTTCCTTGG - Intergenic
929418625 2:41768796-41768818 ATTCCTCATGGTTCCTTTCTTGG - Intergenic
930530216 2:52580378-52580400 ATGGCTCAGGTCTCCATTCTAGG + Intergenic
932064904 2:68544756-68544778 AGGGCACATGGGACCTTTCTAGG + Intronic
932089140 2:68789496-68789518 AATGCTAATGTCCCCTTTCTTGG - Intronic
933351636 2:81159899-81159921 ATGGCTCATGGGCCATTACCTGG - Intergenic
934775305 2:96933563-96933585 CTGGCTCCTGCCCCCCTTCTGGG + Intronic
936786371 2:116098466-116098488 ATGGCTCATTGCCCAGCTCTGGG + Intergenic
937468986 2:122159110-122159132 ATGGCTGATGGCCCGGCTCTGGG + Intergenic
938228148 2:129635598-129635620 AAAGCACAGGGCCCCTTTCTGGG + Intergenic
944682952 2:202093384-202093406 GTGGCTAATGGCCACTTTATTGG - Intronic
946448851 2:219762774-219762796 ATGCCTGATGGCCTCTCTCTGGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948296237 2:236862766-236862788 ATGGGTCCCGGCCCCTCTCTGGG + Intergenic
949036805 2:241819248-241819270 CTGGCTCATGGCCCGTGTGTAGG + Intergenic
949036873 2:241819702-241819724 CTGGCTCATGGCCCGTGTGTAGG + Intergenic
949036889 2:241819816-241819838 CTGGCTCATGGCCCGTGTGTAGG + Intergenic
1168852639 20:987211-987233 CTGGCCCCTGGCCCCTGTCTGGG + Intronic
1169001301 20:2169654-2169676 ATGGCACATGGGCCCTGGCTTGG + Intronic
1173922770 20:46758504-46758526 CTGGCTGATGGCCCCTGTGTTGG - Intergenic
1174408467 20:50318360-50318382 AAGCCTCATGGCCCATTTCCAGG - Intergenic
1175458912 20:59136148-59136170 TTGGCTCATGGCCCCCTTCAAGG + Intergenic
1176806469 21:13488698-13488720 GGGTCTCATGGCCCCCTTCTTGG - Intergenic
1177718107 21:24866652-24866674 ATGGCTCATTGTTCCTTTATTGG - Intergenic
1179098287 21:38335027-38335049 ATGGCTCTTGGCCACTGTCAGGG - Intergenic
1179164435 21:38924672-38924694 GGGACTCATCGCCCCTTTCTTGG - Intergenic
1179561607 21:42219268-42219290 CTGTCTGATGGCCGCTTTCTCGG + Exonic
1179798014 21:43796958-43796980 ATGGTCCTCGGCCCCTTTCTGGG + Intronic
1180148859 21:45937426-45937448 AAGGCTCATGCCCCTTTCCTTGG + Intronic
1181282857 22:21732045-21732067 ACGGCTCCTAACCCCTTTCTGGG + Intronic
1182108281 22:27704661-27704683 ATGGGTCCTAGGCCCTTTCTGGG + Intergenic
1182619478 22:31610981-31611003 ATGGACCATGGCCCCTCTCTAGG - Intronic
1183037301 22:35150023-35150045 ATGGCTCATGACCCCTTTCCTGG + Intergenic
950089770 3:10287356-10287378 TTGGCTCAGAGCCTCTTTCTAGG - Intronic
954198707 3:49011613-49011635 ATGGCTCTTTGCCTCTATCTAGG + Exonic
955656065 3:61246354-61246376 CTGGATCAAGACCCCTTTCTGGG + Intronic
956750821 3:72342546-72342568 CAGGCTCATGGTCCCTTCCTCGG + Intergenic
959203649 3:103279236-103279258 ATGGCTCTTGGCCTGTTACTGGG - Intergenic
963355661 3:144206851-144206873 ACAGCTCTTGGCCCATTTCTGGG - Intergenic
969251251 4:5970211-5970233 AGGGCTCAGGGCACCTTCCTGGG - Intronic
969373387 4:6747986-6748008 TTGGCTCAGGTCCCCTTCCTAGG - Intergenic
969515008 4:7642239-7642261 TTTGCTCCTGGCCCCTTCCTTGG + Intronic
970072498 4:12177293-12177315 CTGGATCAGGACCCCTTTCTAGG + Intergenic
975881438 4:78912312-78912334 AAAGCACATGGCACCTTTCTAGG + Exonic
979609568 4:122674804-122674826 ATGGAACAAGGCCCCTTTCTGGG - Intergenic
981125430 4:141100696-141100718 TTGGCTCAGGACACCTTTCTTGG - Intronic
981530988 4:145753642-145753664 ATGGCTCACAACCCCTTTCATGG + Intronic
984240845 4:177217843-177217865 ATGGCTGAGGTCCCCATTCTAGG - Intergenic
985431547 4:189886080-189886102 TTGGCTCCTGGCCCCCTTCCAGG - Intergenic
985720876 5:1488056-1488078 ATGGCTCAGGGTACCCTTCTTGG - Intronic
986280301 5:6316794-6316816 CTGGGCCATGGTCCCTTTCTGGG - Intergenic
987425431 5:17767481-17767503 ATGGCTTATGGCTCCTGTGTTGG - Intergenic
993044408 5:82851104-82851126 ATGGCTAATGGCCACTATATTGG - Intergenic
993264167 5:85700235-85700257 ATGGCAGATGGCAACTTTCTGGG - Intergenic
995255918 5:110046509-110046531 ATGGTTTTTGGCCACTTTCTAGG - Intergenic
996088867 5:119330952-119330974 TTGGCTCTTGGCCTTTTTCTTGG - Intronic
998316202 5:141184738-141184760 ATGCCTGAGGGCCCCTTTCCAGG + Exonic
998369804 5:141653764-141653786 ACAGGTCATGGCCCCTCTCTGGG - Exonic
999622757 5:153489549-153489571 AGGGCTCATGGCCACTTTACAGG + Intergenic
1002911095 6:1491462-1491484 GGGGCTCATTGCCCCTTCCTTGG + Intergenic
1003250637 6:4426677-4426699 ATTCCTCAAGACCCCTTTCTGGG + Intergenic
1008872540 6:56289729-56289751 TTAGCCCCTGGCCCCTTTCTTGG + Intronic
1014004179 6:116397900-116397922 ATGTCTCATTGCCTTTTTCTTGG + Intronic
1017233165 6:152094130-152094152 AAGGCTAACAGCCCCTTTCTGGG + Intronic
1017728247 6:157290999-157291021 ATGGCCCCTGGCTCCTTCCTAGG + Exonic
1017876538 6:158529496-158529518 GGGGCTCATGGCCTCTTTCATGG - Intergenic
1018902790 6:168059691-168059713 AGAGCTCACGTCCCCTTTCTGGG + Intronic
1020437040 7:8175764-8175786 ATGCCTCATGGTCATTTTCTAGG + Intronic
1020873116 7:13658406-13658428 CTGGTTCATGGCCACTTGCTGGG - Intergenic
1023670935 7:42575890-42575912 AAGGCATAGGGCCCCTTTCTTGG - Intergenic
1027671620 7:81106431-81106453 ATGGCTCTTGACCATTTTCTGGG + Intergenic
1029015854 7:97314898-97314920 ATGGAGCAGGGACCCTTTCTAGG - Intergenic
1029460407 7:100691082-100691104 ATGGTGCCTGGCCCCTTCCTTGG + Intergenic
1031663245 7:124453647-124453669 CTGGCTCTTGGACCCTTGCTTGG + Intergenic
1032173891 7:129608382-129608404 CTGGCTCAAGGCACCTTTTTTGG + Intergenic
1032234979 7:130113194-130113216 ATGGCTCATGGCTACTGACTTGG + Intronic
1032252518 7:130270430-130270452 ATGGCTCATCCTACCTTTCTGGG - Intronic
1035471550 7:159112909-159112931 GAGGCTCATGGCGCCTTCCTGGG + Intronic
1036462394 8:8964925-8964947 GTGCCTCATGGTTCCTTTCTAGG + Intergenic
1037539251 8:19855767-19855789 ATGGCTCATGGCAGCCTCCTGGG + Intergenic
1037763175 8:21755816-21755838 ATGGCTGAAGGCCCTTGTCTTGG - Intronic
1038276784 8:26127945-26127967 ATGGCTCTTGGCCACTTTGTGGG - Intergenic
1039555104 8:38469503-38469525 AAGGCTCTTGGCTCCTTCCTGGG - Intergenic
1044012437 8:87011076-87011098 ATGGCTCATTGAGCCTTTCTAGG + Intronic
1045185202 8:99830577-99830599 ATGGCTTAAGCCCCCTTTCCAGG + Intronic
1046465049 8:114590277-114590299 CTGGTTCTTGGCCCCTTTGTTGG - Intergenic
1048006403 8:130422708-130422730 CTGGCTCCTGTCCCCTTTATGGG - Intronic
1048549072 8:135416823-135416845 ATGGCTCATGGCTCCTGGCATGG - Intergenic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1049700348 8:144008362-144008384 AGGGATCTTTGCCCCTTTCTTGG - Intronic
1050850197 9:10275615-10275637 ATGGATACTGGCCCCTTTTTTGG - Intronic
1051191488 9:14517664-14517686 ATAGCCCATGGCCCTGTTCTTGG + Intergenic
1052047318 9:23809745-23809767 AGAGCACATGGCCTCTTTCTAGG + Intronic
1052681810 9:31702337-31702359 ATAGCTCAAGGTCCTTTTCTAGG + Intergenic
1056108241 9:83369140-83369162 ATGACACCTGGCCCATTTCTAGG + Intronic
1057255715 9:93545451-93545473 AAGCCCCATGGCCCCTTACTTGG + Intronic
1057978328 9:99630712-99630734 GTGGCTCATGGCCACCTTTTTGG + Intergenic
1190713186 X:53083743-53083765 ATGGCTCAAGCACCCTTTCTGGG - Intronic
1191021375 X:55864490-55864512 ATGGCTTATGGTCTATTTCTGGG - Intergenic
1192547343 X:72025281-72025303 ACGGCTTAGGGACCCTTTCTAGG - Intergenic
1197618660 X:128722153-128722175 ATGTCTCAAGGCCCATGTCTGGG + Intergenic
1199191193 X:144973377-144973399 ATAACTCATTGCCACTTTCTTGG + Intergenic
1200837554 Y:7748138-7748160 ATGGCTAATGGCTACTATCTTGG - Intergenic
1200920267 Y:8606911-8606933 ATGGTTCTTGGCCTCTTTGTGGG + Intergenic
1202016399 Y:20411175-20411197 ATGTCTCATGGCCTATTTGTAGG - Intergenic