ID: 1137429436

View in Genome Browser
Species Human (GRCh38)
Location 16:48406627-48406649
Sequence TAGGGTGGTAATGATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137429436_1137429438 -6 Left 1137429436 16:48406627-48406649 CCTGCAGTATCATTACCACCCTA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1137429438 16:48406644-48406666 ACCCTATGAGATAGTCACCATGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137429436 Original CRISPR TAGGGTGGTAATGATACTGC AGG (reversed) Intronic
902403188 1:16169089-16169111 AAGGGTGGGAATGAGACCGCAGG + Intergenic
905274796 1:36810246-36810268 TAGGGTGGTGATGATAGCTCTGG - Intronic
905697986 1:39990007-39990029 CAGGGTGGTAGTGATAATGATGG - Intergenic
905893939 1:41533335-41533357 GAGGGAGGCAATGACACTGCTGG - Intronic
906076770 1:43057710-43057732 TGTGGTGGTAGTGATACTGATGG + Intergenic
909635720 1:77814814-77814836 TTGGGTGATAATGAAGCTGCTGG + Intronic
916155680 1:161844501-161844523 TAGGGTGGTAGAGATACTGGAGG + Intronic
916290786 1:163164140-163164162 TAGGCTGGTAATCAAAATGCTGG - Intronic
917215155 1:172670521-172670543 TCGGCTGGTAGTGATACTACTGG + Intergenic
921479215 1:215644582-215644604 GAGGGTGGTAATGAAAATGAGGG + Intronic
924576363 1:245284376-245284398 TGGGCTGGTAATAATACTCCAGG - Intronic
1063278171 10:4594587-4594609 TACGGTGGTAAGAATTCTGCAGG + Intergenic
1063278178 10:4594695-4594717 TACGGTGGTAAGAATTCTGCAGG + Intergenic
1065139756 10:22708692-22708714 TCGGGTGGTACTGATGCTGCAGG - Intronic
1077416992 11:2428631-2428653 GAGGGTGGTGATGATAGTGATGG + Intergenic
1079001513 11:16761401-16761423 TAGGGTGGTAATGGGAGTGGTGG + Intergenic
1079443805 11:20541251-20541273 AAGAATGGTAATGATACTGATGG + Intergenic
1087500501 11:98945758-98945780 CAGGGCATTAATGATACTGCAGG - Intergenic
1088251533 11:107865336-107865358 TATGGTGGTAATGAGACTACAGG - Intronic
1088621811 11:111692492-111692514 TGGAGTGGTAAGGAAACTGCAGG + Intronic
1098153343 12:67571418-67571440 TAAGGTGGTGATTATACTGCAGG - Intergenic
1102737707 12:115178131-115178153 TATGGTGGTGATGATGCTGATGG - Intergenic
1102737711 12:115178167-115178189 TATGGTGGTGATGATGCTGATGG - Intergenic
1106801293 13:33259084-33259106 TAGAGAGGTAATGATAGTACAGG - Intronic
1107465246 13:40643879-40643901 AATGGGGATAATGATACTGCTGG - Intronic
1108052910 13:46463757-46463779 TAGGGTGGTGATATTACTCCCGG - Intergenic
1111890872 13:94081270-94081292 AATGGTGGTAGTAATACTGCTGG - Intronic
1113859767 13:113473700-113473722 GAGGGTGGTAACGTTACAGCTGG + Intronic
1119654454 14:76407244-76407266 TTGGGTGATACTGATGCTGCTGG + Intronic
1119924445 14:78479434-78479456 TTGGGTGATGCTGATACTGCTGG + Intronic
1122180631 14:99951688-99951710 CAGGGTGGTAGTGATATGGCTGG - Intergenic
1126728019 15:51652784-51652806 TGAGGTGGTAATGATACTGATGG - Intergenic
1127000504 15:54498825-54498847 TAGGGTTGTATTGAAACTGTAGG - Intronic
1127846251 15:62874092-62874114 TAGTGAGGTAATAATACTGCTGG + Intergenic
1129519408 15:76176474-76176496 TAAGGTGGGAATGCTACTGAGGG + Intronic
1131059638 15:89396841-89396863 GAGGGTGGTAGTGATGTTGCTGG + Intergenic
1131631917 15:94186590-94186612 TGAGGTGGTAATGCTAGTGCTGG - Intergenic
1132476598 16:142335-142357 TGGGATGGAAATGAGACTGCAGG + Intergenic
1135176599 16:20235306-20235328 CTGGGTGCTAGTGATACTGCAGG + Intergenic
1137429436 16:48406627-48406649 TAGGGTGGTAATGATACTGCAGG - Intronic
1140999749 16:80297326-80297348 GAGGGTGGAAGTGACACTGCTGG - Intergenic
1141987505 16:87589407-87589429 TATGGTGGTGCTGATGCTGCTGG - Intergenic
1143795487 17:9332882-9332904 TAGGGAGGTAATGATATTTTTGG + Intronic
1145146257 17:20482483-20482505 TAGGGTAGCAAAGACACTGCAGG + Intergenic
1147041136 17:37719965-37719987 GATGGTGATAATGATACTGATGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1152434914 17:80270555-80270577 TTGGGTGGAAATGGCACTGCAGG + Intronic
1156009972 18:32485849-32485871 TAGGATAGAAATGATTCTGCAGG + Intergenic
1156211498 18:34948816-34948838 TCAGGTGGTATTGATGCTGCTGG + Intergenic
1156418823 18:36928185-36928207 TATGGTGGTGGTGATAGTGCTGG + Intronic
1157436475 18:47674120-47674142 TGGGTTGGTAATGGTAGTGCAGG + Intergenic
1158747679 18:60219896-60219918 TAAGGTGGTAAAGATACTTCCGG - Intergenic
1159776950 18:72613507-72613529 TAGGGTGGAAATGGAATTGCAGG - Intronic
1160445141 18:78921814-78921836 TCGGGTGGTACTGAGGCTGCTGG - Intergenic
1167304045 19:48696688-48696710 CAGGGTGGAAGTGATAATGCCGG + Intronic
928811055 2:35226699-35226721 TATGGTGGTAGTGATATTGATGG + Intergenic
932873464 2:75426667-75426689 TATGGAGGTATTGATGCTGCTGG + Intergenic
934630012 2:95908339-95908361 TTGGGTGATGATGATGCTGCTGG - Intronic
934791142 2:97061448-97061470 CAGTGTGCTAATGATCCTGCTGG - Intergenic
934815304 2:97321082-97321104 CAGTGTGCTAATGATCCTGCTGG + Intergenic
934822391 2:97387401-97387423 CAGTGTGCTAATGATCCTGCTGG - Intergenic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936680075 2:114760024-114760046 TAGGGTGGTAATGGTGCAGGTGG - Intronic
936958772 2:118050783-118050805 TAGGATGTTAATAATGCTGCGGG - Intergenic
937649404 2:124303184-124303206 TATGCTGGTAATGATTCAGCAGG - Intronic
947332962 2:229049450-229049472 TGGGGTGGTAATGACAATCCTGG + Intronic
948225360 2:236305593-236305615 TTGGGTGATACTGATGCTGCAGG - Intergenic
1177527300 21:22311058-22311080 TTGGGTGGTAATGAAAATGTCGG + Intergenic
1179793563 21:43769384-43769406 TGGGCTGGTAAGGATACTGTTGG + Intergenic
1181439188 22:22927083-22927105 TGGGGTGGTGGTGAGACTGCTGG - Intergenic
1181715932 22:24728759-24728781 TAGGATGGAAATGATATTGCAGG - Intronic
1185003470 22:48261481-48261503 TATGGTGGTAATGGTAATGACGG - Intergenic
950909654 3:16575732-16575754 TAGGGTGGTAGTTAAACTGGGGG + Intergenic
951601772 3:24384577-24384599 AAGGGTGGAAATTATACTGAGGG - Intronic
952438947 3:33303346-33303368 TAGGGAGGTAATGAAAATGAGGG - Intronic
955366532 3:58314983-58315005 TAGTTTGTTAAAGATACTGCTGG - Intronic
956946633 3:74230785-74230807 TAAGGTGATACGGATACTGCTGG + Intergenic
962199593 3:133390445-133390467 TTGGGTGTTATTGATACTGCTGG - Intronic
963848053 3:150179979-150180001 TAGGGCGGGAAGGATACTGGAGG + Intergenic
964776248 3:160281410-160281432 GAGGGTGGAAATGTTACAGCAGG + Intronic
965815677 3:172634256-172634278 TAGGGTGGTGATGGTAATGATGG - Intronic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
966740591 3:183229600-183229622 AAGGGTGGAAATGAGACTGATGG - Intronic
967554666 3:190841002-190841024 AAGGGTTGTAATGATACTGATGG + Intergenic
979809896 4:125023632-125023654 GAGGCTGGTAATAATATTGCTGG + Intergenic
980112695 4:128649710-128649732 TGGAGAGGTAAGGATACTGCTGG + Intergenic
981467147 4:145086463-145086485 CCAGGTGGTAATGATGCTGCTGG - Intronic
981559312 4:146029695-146029717 TAGGATGGGAATGAGACAGCAGG - Intergenic
986400166 5:7372085-7372107 TAGGGTGGTGATGATGGTGGTGG - Intergenic
989255283 5:39359609-39359631 AAGGGAGGTATTGATGCTGCAGG + Intronic
995222332 5:109663987-109664009 TAGGGTGGAAGTGATACAGAAGG - Intergenic
1001687529 5:173605337-173605359 CAGGGTGATGCTGATACTGCTGG + Intergenic
1003251228 6:4430691-4430713 TAGGGTGATGCTGATGCTGCTGG - Intergenic
1006255099 6:32826374-32826396 CTGGGTGGGAAAGATACTGCAGG + Intronic
1007634957 6:43293970-43293992 GATGGTGGTAATGATGCTGGTGG - Intergenic
1007634994 6:43294265-43294287 GATGGTGGTAATGATGCTGGTGG - Intergenic
1007635012 6:43294384-43294406 GATGGTGGTAATGATGCTGGTGG - Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1014041482 6:116832062-116832084 CAGGCTGGAAATGATACTCCGGG + Intergenic
1015879645 6:137858409-137858431 TAGGGTCTGAATCATACTGCTGG - Intergenic
1019765973 7:2850605-2850627 TAGGGTGATAGTGATAGTGATGG - Intergenic
1022569798 7:31441210-31441232 TCAGGTGGTACTGATGCTGCTGG - Intergenic
1022783364 7:33609801-33609823 GTGGGTGGTAATGATATTCCTGG + Intergenic
1024304174 7:47913047-47913069 TCAGGTGGTCATGATGCTGCTGG + Intronic
1026740858 7:72977426-72977448 TAGGGTGGGAATGAAAAAGCGGG + Intergenic
1027102875 7:75387648-75387670 TAGGGTGGGAATGAAAAAGCGGG - Intergenic
1030688490 7:112509679-112509701 TATAGTGGTAATGATACAGAAGG - Intergenic
1030875237 7:114805711-114805733 CGGGGTGGTAATGAGACAGCAGG - Intergenic
1031547440 7:123068028-123068050 TGGGGTGGTAATGGGTCTGCTGG + Intergenic
1031939177 7:127769137-127769159 TAGTGAGGTCTTGATACTGCTGG + Intronic
1032610588 7:133408280-133408302 TAGGGTGGTAGTGATGATGGAGG + Intronic
1032610632 7:133408487-133408509 TAGGGTGGTAAGGATGATGGAGG + Intronic
1032670775 7:134080598-134080620 TAGGGTGGTAGTAATACGGATGG + Intergenic
1040914391 8:52554447-52554469 TAGGGTGGTTAATTTACTGCTGG - Intronic
1043972823 8:86551419-86551441 TAGGGTGGTAATGGTAATTACGG + Intronic
1044176082 8:89124452-89124474 TATGGTGGTAATGATACAAATGG + Intergenic
1045004002 8:97901650-97901672 TTGGGTGCCAAGGATACTGCAGG + Intronic
1046786278 8:118270441-118270463 CGGGATGGTAATGATATTGCTGG - Intronic
1047778169 8:128090709-128090731 TAGGGTGGTAATGAGCATGGGGG - Intergenic
1048546993 8:135396535-135396557 CAGGGAGGAAATGAGACTGCAGG + Intergenic
1050446859 9:5733226-5733248 TTGGGTGGTGATGATATGGCTGG - Intronic
1050614870 9:7391537-7391559 GAAGGTGCTAATGATACTGTGGG - Intergenic
1051121279 9:13755167-13755189 TAGGGTGGTTGTGATACTCACGG + Intergenic
1051286993 9:15507858-15507880 TTGGGTGGTAATGATTCTGTTGG - Intronic
1055381613 9:75713447-75713469 TCGGGAGGCAATGATATTGCTGG - Intergenic
1055759735 9:79594255-79594277 TCAGGTGATACTGATACTGCTGG + Intronic
1056039328 9:82645800-82645822 AAGGCTGGTAATGTTACTGAAGG - Intergenic
1061845058 9:133383083-133383105 GATGGTGGTAATGATAGTGGTGG + Intronic
1187664166 X:21585402-21585424 CAGGGTGGTAATAATAGAGCTGG + Intronic
1200468059 Y:3545941-3545963 TAGGGTGGTTAAGAGAGTGCTGG - Intergenic