ID: 1137432774

View in Genome Browser
Species Human (GRCh38)
Location 16:48432032-48432054
Sequence CCTTCCAAGGATGGGCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137432774_1137432780 16 Left 1137432774 16:48432032-48432054 CCCTAAAGCCCATCCTTGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1137432780 16:48432071-48432093 CTCTAAGAGTCTAAGAACTTAGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137432774 Original CRISPR CCTTCCAAGGATGGGCTTTA GGG (reversed) Intronic
901781613 1:11598199-11598221 CCTTCCAAGGATGGAGTCTCAGG + Intergenic
902584156 1:17427788-17427810 CCTCCCAAGGAAGGGCTGGAGGG + Intronic
903009105 1:20317854-20317876 CCTTCCCAGGATGGATTTCAAGG + Intronic
904009313 1:27380871-27380893 CCTTAGAAGGTAGGGCTTTAGGG + Intronic
905841700 1:41186052-41186074 CCTAGCAAGGACTGGCTTTAAGG - Intronic
906317051 1:44793214-44793236 TCTTCCCAGGCTGGGATTTAAGG - Intergenic
917687313 1:177430451-177430473 CTTTCTAAGGCTGGGCTATAAGG - Intergenic
917924074 1:179774392-179774414 GGCTCCAAGGATGAGCTTTAGGG + Intronic
920583142 1:207132080-207132102 CCTCCCCAGTATGGGCTTTGGGG + Intronic
924428741 1:243978648-243978670 CCTTCCTAGGACTGGCTATAGGG - Intergenic
1062925996 10:1315640-1315662 CCTCCCAGGGAGGGGCTTTGAGG + Intronic
1063699249 10:8368923-8368945 ATTTCCAAGTATGTGCTTTATGG - Intergenic
1065260222 10:23916006-23916028 AATGCCAAGGATGGGCTTTTAGG + Intronic
1069564443 10:69453867-69453889 ACTTCCAGGGATGGGAGTTAAGG - Intronic
1069742962 10:70697174-70697196 CCTTCCAAGGCTGGCCTATCTGG - Intronic
1071993573 10:91125147-91125169 CCTTCCAAGAATGTGCCCTAAGG + Intergenic
1074078505 10:110150442-110150464 CCCTCCGAGTAGGGGCTTTATGG + Intergenic
1075259474 10:120949994-120950016 CCTTCCAAGGATGGCATTCCCGG - Intergenic
1078461177 11:11516263-11516285 CATTCCAGGGATGGGCTATTTGG - Intronic
1080756529 11:35205577-35205599 CCTTCTAACAATGGGATTTATGG - Intronic
1081541936 11:44040854-44040876 CCTTCCAGGGAGAGGCCTTAAGG + Intergenic
1083271370 11:61574608-61574630 CCATCCAAGGATGGGGGTCAGGG - Intronic
1085220932 11:74873180-74873202 CCTTCCTAGCCTTGGCTTTAGGG - Intronic
1085414690 11:76312255-76312277 CCGGCCAAGGATGGTCTTAAGGG + Intergenic
1086966571 11:93034030-93034052 CTTTCCTAGGATGTGCTCTAGGG + Intergenic
1090214181 11:124946343-124946365 TCTTCCAAGGAAGGGCTTTTTGG - Intergenic
1090944564 11:131418490-131418512 CTTTCAAAGACTGGGCTTTAAGG + Intronic
1093787736 12:23212279-23212301 CCTTGCAAGGATGTGATTCAAGG - Intergenic
1094020750 12:25911471-25911493 CCTTCCACTGATGGGCATTTAGG + Intergenic
1101247447 12:102897894-102897916 CTTTCCAAGAATGGGCTGTGGGG + Intronic
1102090900 12:110186784-110186806 CCTCCCAAGGCTGGGCTTACAGG + Intronic
1106307809 13:28528998-28529020 CATTCCATGGATGTGCTTCAAGG - Intergenic
1111049638 13:82863872-82863894 CTTTACAAGGTAGGGCTTTAGGG - Intergenic
1113382715 13:109818420-109818442 CCTCCCCAGGATGGGCTCAAAGG - Intergenic
1115448188 14:33516303-33516325 CCTTTCAAGGAGGGGTTTCAAGG + Intronic
1120028876 14:79617008-79617030 CCTTCCAAGGATTGACTATCAGG - Intronic
1120298536 14:82676604-82676626 ACTTCTAAGGCTGGGCTTTAGGG + Intergenic
1120624232 14:86804486-86804508 CCTTCAAAGGCTTGGTTTTAGGG + Intergenic
1122469935 14:101959630-101959652 CCTTCTAAGGTTGGGATTCAAGG + Intergenic
1128712857 15:69885110-69885132 CCTCCCATGGAAGGGCTTTGTGG + Intergenic
1135582819 16:23642378-23642400 ACTTCCACGCGTGGGCTTTACGG - Intronic
1137432774 16:48432032-48432054 CCTTCCAAGGATGGGCTTTAGGG - Intronic
1137745335 16:50816279-50816301 CCTCCCAAGGATGAGCTGTCAGG + Intergenic
1140018966 16:71218293-71218315 ACTTCCAAACATGGGTTTTATGG - Intronic
1141946290 16:87312101-87312123 AGTGCCAAGGGTGGGCTTTAGGG - Intronic
1143671070 17:8396590-8396612 CCTTCCAATGATGGCCTCTCTGG + Intronic
1143688496 17:8539313-8539335 CATTCCAGGGATGAGTTTTATGG - Intronic
1144081672 17:11769078-11769100 CCTGCCAAGGGTGGGCTCTAGGG - Intronic
1144107559 17:11999340-11999362 GGTTCCAAGGATGGGTTTCAAGG - Intergenic
1144460563 17:15455406-15455428 CCTGCCTAGGATAGGCCTTATGG - Intronic
1145929470 17:28674804-28674826 AGTTTCAAGGATGGGCTTTGAGG + Intronic
1146254002 17:31378351-31378373 CTCTCCAAGGATGGGCTGTTGGG + Intronic
1149519113 17:57304907-57304929 ACTGCCAAGGATGGGCTGTGGGG - Intronic
1154073891 18:11180043-11180065 CCTTGCAACTATGAGCTTTAAGG - Intergenic
1154136222 18:11781322-11781344 CAATCCAAGGTTGGGCTTTCTGG - Intronic
1155613667 18:27697525-27697547 TCTTCCCAGGAAGGGCTTTCAGG - Intergenic
1156873072 18:41970604-41970626 CTTTCCAAGGGTGAACTTTATGG - Intronic
1157113133 18:44839741-44839763 CCTTCCCTGTATGGGTTTTAAGG + Intronic
1159269796 18:66133912-66133934 CCTATCAAGGATGGCCTTCAAGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1166432758 19:42741000-42741022 GCTTCCAAGGATGGACATTCAGG + Intronic
1166445745 19:42856256-42856278 GCTTCCAAGGATGGACATTGAGG + Intronic
1166448731 19:42880216-42880238 GCTTCCAAGGATGGACATTCAGG + Intronic
1166453138 19:42918404-42918426 GCTTCCAAGGATGGTCATTCAGG + Intronic
1166455621 19:42937715-42937737 GCTTCCAAGGATGGACGTTCAGG + Intronic
1166465413 19:43026990-43027012 GCTTCCAAGGATGGACATTGAGG + Intronic
1166482684 19:43187010-43187032 GCTTCCAAGGATGGACCTTCAGG + Intronic
1166492309 19:43270062-43270084 GCTTCCAAGGATGGACTTTCAGG + Intergenic
1166741955 19:45119862-45119884 CCGCCCCAGGAGGGGCTTTAGGG + Intronic
927854929 2:26521998-26522020 CCTTTGCAGGATGGGCTTCAGGG + Intronic
927892163 2:26758406-26758428 CCTGGCTAGAATGGGCTTTAGGG - Intergenic
929324790 2:40596183-40596205 CTGTCCCAGGATGGGTTTTACGG + Intronic
932279733 2:70480312-70480334 CCTTCCAAGGTTGGGCTGTTTGG + Intronic
933271514 2:80238037-80238059 CCGTCCAAGGACAAGCTTTAAGG + Intronic
936379070 2:111968319-111968341 CCTTCCAAGGATGGGCATGGAGG + Intronic
937694471 2:124792543-124792565 CCTTAAAAGGGTGGGTTTTATGG - Intronic
937806996 2:126158162-126158184 CTCTCCAAAGATGGGGTTTAGGG - Intergenic
938244169 2:129764611-129764633 CCTTCCAAGGATGGACGTGAAGG - Intergenic
939236607 2:139502488-139502510 CCTTCCATTGATGGGCATTTTGG - Intergenic
939299582 2:140318337-140318359 CATTACAAGAATGGGCTTTGAGG + Intronic
940358870 2:152775961-152775983 CATACCAAGGATGTGATTTATGG + Intergenic
944795527 2:203180671-203180693 CCTTCCAGGGAAGTGCTATAGGG + Intronic
944859379 2:203800046-203800068 CTCTCCAGGGATGGGCTTTTGGG + Intergenic
946684721 2:222256229-222256251 CCTTACAAGGATCTGCCTTATGG - Intronic
947757346 2:232576560-232576582 ACTTCCAAGCCTGTGCTTTAAGG - Intronic
948064741 2:235069155-235069177 GGATCCATGGATGGGCTTTAGGG + Intergenic
948441777 2:237996346-237996368 CATCCCAAGCATGGGCTTTGTGG + Intronic
1168898268 20:1338668-1338690 CCTTCCAGGTATGGCCTTTGGGG + Intronic
1170214625 20:13878233-13878255 GTTTCCAAGGAGGGGCTTTCCGG - Intronic
1170389956 20:15861512-15861534 CCTTCAAAGGATGGATTATAAGG - Intronic
1170850795 20:20002852-20002874 CCTTCCAAGCATGGGGAGTATGG - Intergenic
1172198398 20:33107952-33107974 CCTTCCAAGCATGGGGCTGAGGG + Intronic
1172366025 20:34350192-34350214 CGATCTAAGGATGGACTTTAGGG + Intergenic
1174034338 20:47658578-47658600 CCTGGCAAGGATGGCATTTAAGG + Intronic
1175113416 20:56664876-56664898 CCTACGATGGATGGGTTTTATGG + Intergenic
1179309489 21:40183194-40183216 CCTTCCAAGGAAGGGAATAAAGG + Intronic
1180076182 21:45464251-45464273 TCTTCCCAGGATGGGATTTTGGG + Intronic
1181687363 22:24538740-24538762 CCTTCCAAGGTTGGGATTACAGG + Intergenic
1182969643 22:34561356-34561378 CTGTCCCAGGATGGGCTTTGGGG - Intergenic
1185030485 22:48440433-48440455 TCTTCCGAGGATGGCTTTTAAGG + Intergenic
949565473 3:5240797-5240819 ATTTCCAAAGATGGGTTTTATGG + Intergenic
950122241 3:10489531-10489553 CTTTCCCAGGATGGGATTCATGG + Intronic
952134569 3:30402629-30402651 CAGTCCAAGAATGGGCATTAGGG + Intergenic
952374624 3:32755789-32755811 TTTTCCAAGGATGGGCATTCTGG + Intronic
952733661 3:36666283-36666305 CCAACCAAGGATGGGATTTCAGG - Intergenic
952903272 3:38123311-38123333 CCTTTCAAGGCTGGCCCTTAAGG + Exonic
953505570 3:43482785-43482807 CCTTGCAAGGATGGGTTGCAGGG + Intronic
955499541 3:59570360-59570382 CCTTGTAAGGGTGGGTTTTAAGG - Intergenic
958777679 3:98505469-98505491 CCTTCCAGGAATGGGATTGAGGG + Intronic
961642092 3:128371217-128371239 CCATCCAAGGATGAGCCTCAGGG - Intronic
965451891 3:168848174-168848196 CCTTCCCAGGGAGGGCTTCAGGG - Intergenic
965555664 3:170015773-170015795 CCTTAAAAGTATGAGCTTTATGG - Intergenic
965804797 3:172531103-172531125 CCTTCTATTGATGAGCTTTAGGG + Intergenic
966619020 3:181944403-181944425 TCTTCTATTGATGGGCTTTAAGG + Intergenic
967221341 3:187250456-187250478 GCTTCCAAGGGTGAGCTTGAAGG + Intronic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
970114579 4:12680056-12680078 TTTTCAAAGGATTGGCTTTAGGG - Intergenic
972180933 4:36464465-36464487 ACTTCCAGGGAAGGGCTTTGAGG - Intergenic
976936220 4:90637909-90637931 CTTTCCAAGTTTGGTCTTTAAGG - Intronic
979648241 4:123097690-123097712 CCTTCCAAGTTTTGGCTTTGGGG + Intronic
981002403 4:139840420-139840442 ACTTCACATGATGGGCTTTAGGG + Intronic
981058367 4:140391221-140391243 CCTACCAAGAATGGGCTTTGGGG + Intronic
981437643 4:144745525-144745547 ACTTGAAAGGATGGGGTTTAAGG - Intergenic
982996596 4:162356374-162356396 GCTTCCAAGCATGTGGTTTACGG - Intergenic
991617029 5:68507664-68507686 CCTTGCAATGATGGGCTGAATGG + Intergenic
995239119 5:109865808-109865830 CCTTTCAAGGACAGGCTTGATGG - Intronic
996689448 5:126323335-126323357 ATTTCAAAGTATGGGCTTTAGGG + Intergenic
999329304 5:150661899-150661921 AGATCCATGGATGGGCTTTAGGG - Intronic
999721008 5:154399307-154399329 CCTTCCAAGGACGGGCTAGGGGG - Intronic
1000633775 5:163620384-163620406 ACTTCCAAGGAAGGACTTAATGG + Intergenic
1002535095 5:179871789-179871811 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535111 5:179871836-179871858 CCTTCCCAGGATGGGCTTGGGGG + Intronic
1002535127 5:179871883-179871905 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535142 5:179871930-179871952 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535158 5:179871977-179871999 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535174 5:179872024-179872046 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535190 5:179872071-179872093 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535206 5:179872118-179872140 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1002535222 5:179872165-179872187 CCTTCCCAGGATGGGCGTGGGGG + Intronic
1009533154 6:64846176-64846198 CCTACCAATAATGGGCTTTGTGG + Intronic
1013253376 6:108358031-108358053 TCTTCCAAGTAAAGGCTTTATGG + Intronic
1013269452 6:108532458-108532480 CCTTCCATGGTTGGATTTTATGG + Intergenic
1014915028 6:127136165-127136187 CCTTCCAGAGAAGGGCTCTATGG + Intronic
1019501051 7:1364948-1364970 CCTTCCCAGGCTGGGCTGCATGG + Intergenic
1021136850 7:16975577-16975599 CCATCCAATGATGAGCTTTTTGG + Intergenic
1021541179 7:21760374-21760396 CCTTCCAAGGATGGGCAAGTCGG - Intronic
1022979882 7:35594433-35594455 CCTTTCAGGGATGGGCTTCAGGG - Intergenic
1026738974 7:72966635-72966657 CCTTCAAAGGATCTGCTTCAGGG + Intronic
1027104759 7:75398438-75398460 CCTTCAAAGGATCTGCTTCAGGG - Intronic
1029527721 7:101105164-101105186 CCTTCCAAGAAAGGGGTTCAGGG + Intergenic
1029933561 7:104399026-104399048 CTTTCTAAGGACAGGCTTTATGG + Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1031079662 7:117246166-117246188 CCTGCCATGGATGGGCATTGAGG + Intergenic
1031998906 7:128251993-128252015 CCTTCCCAGGATGGGCTTCTTGG - Exonic
1034735989 7:153430031-153430053 GCCTCCAAGTAGGGGCTTTAGGG - Intergenic
1035839231 8:2792960-2792982 TCTTCTAAGTAAGGGCTTTATGG - Intergenic
1038348932 8:26758704-26758726 CCTTCCTAGCATGGGCATTGGGG + Intronic
1038704512 8:29881091-29881113 CCTTCCAAGGAAGGGCATGCTGG - Intergenic
1039233087 8:35470645-35470667 CCTCCCAAGTATGGGCCTAAAGG - Intronic
1041371432 8:57164649-57164671 CCTCCCCAGGATGGTCTTTAAGG + Intergenic
1049264011 8:141656778-141656800 CATTCCATGGATGGGCTCAACGG - Intergenic
1051013213 9:12444591-12444613 ACTTTCAAAGATGTGCTTTAAGG - Intergenic
1051454058 9:17232593-17232615 CCTTCAAAGGATAGGCTTATGGG + Intronic
1053002408 9:34584583-34584605 CCTTCCAAGGCTGGGCTCTGAGG - Intronic
1056780981 9:89550847-89550869 CCATCCAAGGATGGAGTTTTAGG + Intergenic
1057332427 9:94128433-94128455 TCTTCCAAGGCTGGGCGTTGTGG - Intergenic
1060265528 9:122109592-122109614 TCCTGCAAGGATGGGCTTCAAGG + Intergenic
1060312184 9:122472054-122472076 CGTTCCCAGGATTGGATTTAGGG - Intergenic
1061678691 9:132232047-132232069 CCTTCCAAGCAATGGCTTGAAGG - Intronic
1190767631 X:53488662-53488684 CCATCAAAGCAGGGGCTTTAGGG - Intergenic
1191674962 X:63784540-63784562 CCGGACAAGGAAGGGCTTTAGGG + Intronic
1195412153 X:104579342-104579364 TCTTCCACGGATGGGCATTTAGG - Intronic
1197355500 X:125434133-125434155 CCTTCCTAGCTTGGGCTTAAGGG + Intergenic
1199441613 X:147875180-147875202 CCTTCCCACGATGGGGATTATGG - Intergenic
1200418409 Y:2936122-2936144 CCAGCCAAGGATGGGCTGTGAGG - Intronic
1201512664 Y:14782366-14782388 ACTTCCAAGGATGGATTATAAGG + Intronic