ID: 1137438667

View in Genome Browser
Species Human (GRCh38)
Location 16:48479900-48479922
Sequence CTGTTCCAATGTAAAATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137438664_1137438667 2 Left 1137438664 16:48479875-48479897 CCAGGTTTTTCATGATGTCCTTT No data
Right 1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137438667 Original CRISPR CTGTTCCAATGTAAAATCCA GGG Intergenic
No off target data available for this crispr