ID: 1137438978

View in Genome Browser
Species Human (GRCh38)
Location 16:48482964-48482986
Sequence CGGGGTGGCCGCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137438967_1137438978 12 Left 1137438967 16:48482929-48482951 CCTTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG No data
1137438965_1137438978 13 Left 1137438965 16:48482928-48482950 CCCTTTCTCAATGAGCTGTTGGG 0: 11
1: 1554
2: 442
3: 128
4: 165
Right 1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG No data
1137438963_1137438978 28 Left 1137438963 16:48482913-48482935 CCATCGTCATCATGGCCCTTTCT No data
Right 1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137438978 Original CRISPR CGGGGTGGCCGCCGGGCAGA GGG Intergenic
No off target data available for this crispr