ID: 1137439358

View in Genome Browser
Species Human (GRCh38)
Location 16:48484815-48484837
Sequence CCCAGTACCTGGAGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137439351_1137439358 -3 Left 1137439351 16:48484795-48484817 CCCAAGGGCCTGGAGCTGAGCCC No data
Right 1137439358 16:48484815-48484837 CCCAGTACCTGGAGGGTGTCAGG No data
1137439350_1137439358 -2 Left 1137439350 16:48484794-48484816 CCCCAAGGGCCTGGAGCTGAGCC No data
Right 1137439358 16:48484815-48484837 CCCAGTACCTGGAGGGTGTCAGG No data
1137439352_1137439358 -4 Left 1137439352 16:48484796-48484818 CCAAGGGCCTGGAGCTGAGCCCA No data
Right 1137439358 16:48484815-48484837 CCCAGTACCTGGAGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137439358 Original CRISPR CCCAGTACCTGGAGGGTGTC AGG Intergenic
No off target data available for this crispr