ID: 1137442881

View in Genome Browser
Species Human (GRCh38)
Location 16:48511143-48511165
Sequence GGCCCCTGATGCTGGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137442876_1137442881 -9 Left 1137442876 16:48511129-48511151 CCCAGCCAATGCAGGGCCCCTGA No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442874_1137442881 -3 Left 1137442874 16:48511123-48511145 CCGCCTCCCAGCCAATGCAGGGC No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442867_1137442881 12 Left 1137442867 16:48511108-48511130 CCACCAACCCAGTTCCCGCCTCC No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442869_1137442881 5 Left 1137442869 16:48511115-48511137 CCCAGTTCCCGCCTCCCAGCCAA No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442875_1137442881 -6 Left 1137442875 16:48511126-48511148 CCTCCCAGCCAATGCAGGGCCCC No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442865_1137442881 20 Left 1137442865 16:48511100-48511122 CCTGCATCCCACCAACCCAGTTC No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442872_1137442881 -2 Left 1137442872 16:48511122-48511144 CCCGCCTCCCAGCCAATGCAGGG No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442877_1137442881 -10 Left 1137442877 16:48511130-48511152 CCAGCCAATGCAGGGCCCCTGAT No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442866_1137442881 13 Left 1137442866 16:48511107-48511129 CCCACCAACCCAGTTCCCGCCTC No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442870_1137442881 4 Left 1137442870 16:48511116-48511138 CCAGTTCCCGCCTCCCAGCCAAT No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data
1137442868_1137442881 9 Left 1137442868 16:48511111-48511133 CCAACCCAGTTCCCGCCTCCCAG No data
Right 1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137442881 Original CRISPR GGCCCCTGATGCTGGGCCAG AGG Intergenic