ID: 1137444284

View in Genome Browser
Species Human (GRCh38)
Location 16:48522356-48522378
Sequence ACTGACTCCTTGGTGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137444276_1137444284 0 Left 1137444276 16:48522333-48522355 CCTGCGTTGAATCCTGGGCCTGG No data
Right 1137444284 16:48522356-48522378 ACTGACTCCTTGGTGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137444284 Original CRISPR ACTGACTCCTTGGTGAGGTG GGG Intergenic