ID: 1137444284 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:48522356-48522378 |
| Sequence | ACTGACTCCTTGGTGAGGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137444276_1137444284 | 0 | Left | 1137444276 | 16:48522333-48522355 | CCTGCGTTGAATCCTGGGCCTGG | No data | ||
| Right | 1137444284 | 16:48522356-48522378 | ACTGACTCCTTGGTGAGGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137444284 | Original CRISPR | ACTGACTCCTTGGTGAGGTG GGG | Intergenic | ||