ID: 1137445516

View in Genome Browser
Species Human (GRCh38)
Location 16:48529569-48529591
Sequence ATGTGGCCATGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137445516_1137445525 17 Left 1137445516 16:48529569-48529591 CCCTCCTCCCTCCATGGCCACAT No data
Right 1137445525 16:48529609-48529631 TTCCCCCTCCCCTCCACCATGGG No data
1137445516_1137445524 16 Left 1137445516 16:48529569-48529591 CCCTCCTCCCTCCATGGCCACAT No data
Right 1137445524 16:48529608-48529630 CTTCCCCCTCCCCTCCACCATGG No data
1137445516_1137445526 18 Left 1137445516 16:48529569-48529591 CCCTCCTCCCTCCATGGCCACAT No data
Right 1137445526 16:48529610-48529632 TCCCCCTCCCCTCCACCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137445516 Original CRISPR ATGTGGCCATGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr