ID: 1137452350

View in Genome Browser
Species Human (GRCh38)
Location 16:48588695-48588717
Sequence AGCTGTACTATCCAAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137452346_1137452350 12 Left 1137452346 16:48588660-48588682 CCAAAAGAACTTCTGCAATGATG 0: 1
1: 1
2: 3
3: 21
4: 210
Right 1137452350 16:48588695-48588717 AGCTGTACTATCCAAATTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137452350 Original CRISPR AGCTGTACTATCCAAATTGG TGG Intronic
907763040 1:57380494-57380516 AGCTGAATTATCCAAACTGCTGG - Intronic
907795115 1:57708400-57708422 AGCTGTACTGCCTGAATTGGAGG + Intronic
913270107 1:117084863-117084885 AGATAAAATATCCAAATTGGAGG - Intronic
915035580 1:152921018-152921040 AGCTGAACCATCCAAAGTTGAGG - Intergenic
915874367 1:159596785-159596807 AGCTGAGCTATCCAATATGGTGG + Intergenic
1070221147 10:74446777-74446799 CACTGTACTATCTAAATAGGAGG - Intronic
1071700457 10:87927291-87927313 AGCTGTACTATCAGTATTGTAGG + Intronic
1073308466 10:102522303-102522325 AGCTTTACTATCACAAATGGTGG + Intronic
1073482457 10:103795269-103795291 AGCTGTACTGTCCAACGCGGTGG - Intronic
1075893105 10:125971014-125971036 AGCTGTATTATAAAACTTGGGGG + Intronic
1077311838 11:1892226-1892248 AGCTTTATTATACAAAATGGCGG - Exonic
1086583537 11:88426244-88426266 ACCTGTACTAGACAAATTGGGGG - Intergenic
1087126887 11:94637156-94637178 AGCTGTGCTATCTAAGATGGAGG + Intergenic
1087239682 11:95761053-95761075 AGCTGTCCTACCCAAGTTGAAGG - Intergenic
1087747512 11:101966610-101966632 AGCTGAACTATCCAATATGATGG - Intronic
1095305618 12:40635555-40635577 AGCTTTTCTATCCAAATGGAAGG - Intergenic
1099116335 12:78629534-78629556 AGATTTACTATACAACTTGGTGG + Intergenic
1105815557 13:24033201-24033223 AGCAGTTCTGTCCAATTTGGTGG - Intronic
1108463208 13:50688521-50688543 AGCTGTGCTATCCAATATGGTGG + Intronic
1110681976 13:78324758-78324780 AGCTGTACTGTCAATAGTGGAGG - Intergenic
1111846796 13:93520189-93520211 AGCTGCACTTTCCAAGTTGGTGG - Intronic
1120265152 14:82239327-82239349 AGCTGTACAGGCCAAATTGTTGG - Intergenic
1128875272 15:71196404-71196426 AACTGTACGATCCAAATTAGGGG + Intronic
1130334812 15:82949721-82949743 AGCTATGCTATCCAATATGGTGG + Intronic
1137452350 16:48588695-48588717 AGCTGTACTATCCAAATTGGTGG + Intronic
1146842263 17:36164238-36164260 ACCTGTTCATTCCAAATTGGTGG - Intergenic
1146877831 17:36427170-36427192 ACCTGTTCATTCCAAATTGGTGG - Intronic
1149396354 17:56249044-56249066 AGCTGTTCTAACCAAACTGTAGG - Intronic
1150630692 17:66878368-66878390 AGCTGTACTATCAAGCTGGGAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154398585 18:14012987-14013009 CCCTGTACAATCCACATTGGAGG + Intergenic
1155289730 18:24328690-24328712 AGCTGCACTGTCCAATATGGTGG + Intronic
1167642640 19:50690057-50690079 ATCTGTACTGTCCAATGTGGTGG - Intronic
928385557 2:30864836-30864858 AGCTGTGCTGTCCAATATGGTGG + Intergenic
929999817 2:46853717-46853739 AGCTGTGCTGTCCAATATGGTGG - Intronic
930191562 2:48465299-48465321 AGGTGTATTTGCCAAATTGGTGG + Intronic
930494201 2:52118591-52118613 AGCTGTACTTTACAAATAGTAGG - Intergenic
939238515 2:139528940-139528962 ATCTATAATATACAAATTGGAGG + Intergenic
939754948 2:146098913-146098935 AGTTGTACTAGATAAATTGGGGG + Intergenic
940595479 2:155786758-155786780 AGATGTAGTTTCCAAATTTGGGG - Intergenic
940910260 2:159204121-159204143 ACCTGCACTGTCCAATTTGGTGG - Intronic
942444891 2:176071336-176071358 AGCTTTGCTAGCCAAATTGCAGG - Intergenic
942903388 2:181151132-181151154 AGCTGAACTATCCAAATTTAAGG - Intergenic
943997136 2:194784213-194784235 ATCTGTACTGTCCAAGATGGTGG + Intergenic
944782645 2:203035223-203035245 AGCTGTGCTATACAATATGGGGG - Intronic
1170875648 20:20247509-20247531 AACTGCACTATCCAATATGGTGG + Intronic
1175320159 20:58079815-58079837 AGCTGTGCATTCCAAACTGGGGG + Intergenic
1178474119 21:32921448-32921470 AGCTGCACTATCCAATATGGTGG - Intergenic
1184559364 22:45253000-45253022 TGCTGTACTAGCAAAAGTGGTGG - Intergenic
949507373 3:4740234-4740256 AGCTGTAGCATCCAGCTTGGGGG - Intronic
952280989 3:31923191-31923213 AGCTGAGCTATCCAGACTGGTGG + Intronic
952553263 3:34502884-34502906 AGCAGTACTATCAAAATTTTGGG + Intergenic
953475729 3:43204380-43204402 AGCTGTAAGATACAAATTGTGGG - Intergenic
956383658 3:68693223-68693245 AGCTGCACTGTCCAAGATGGTGG + Intergenic
956679664 3:71766765-71766787 AGCTTTACAAGCAAAATTGGGGG - Intergenic
958695737 3:97525975-97525997 AGCCATACTGTACAAATTGGTGG + Intronic
959614987 3:108337056-108337078 AGTAGTACTATTCAAAGTGGGGG + Intronic
960514088 3:118583788-118583810 AAATTTACTTTCCAAATTGGAGG + Intergenic
963643258 3:147883138-147883160 AGCTGTGCTATCCAAGTAGTAGG + Intergenic
970728579 4:19076309-19076331 AGTTTTTCTATCCAAAATGGAGG - Intergenic
970963036 4:21895807-21895829 CCCTGTACTCTCCCAATTGGTGG + Intronic
971396618 4:26234138-26234160 AGCTGTACTATCCAACATTCTGG - Intronic
977797671 4:101186785-101186807 AGCTATATTATCCAAATTAATGG + Intronic
978712544 4:111802507-111802529 AGCTGTGCTGTTCAAAATGGAGG - Intergenic
988181856 5:27805965-27805987 AGCTGTACTTGACAAATTGATGG + Intergenic
990664651 5:58058717-58058739 AGCTGTGGTATCCAAAACGGTGG - Intergenic
994258166 5:97625382-97625404 AGCAGTACAATCCAATTTGCTGG - Intergenic
999828940 5:155300605-155300627 AGCTGCACTGTCCAATGTGGTGG + Intergenic
1000532064 5:162435586-162435608 AGCTGTACTGCTCAATTTGGTGG - Intergenic
1002670590 5:180863048-180863070 AGCTGTGCTATCCAATAAGGTGG - Intergenic
1004086042 6:12450277-12450299 ATCTGAACTGTCCAAATTAGTGG + Intergenic
1006341743 6:33451205-33451227 AGGTGTACTAAGCAAATTAGTGG - Intronic
1006711783 6:36079758-36079780 ATCTGTGCTATCCAATGTGGTGG + Intronic
1007344533 6:41218136-41218158 AGCTGAACTATGAAGATTGGTGG - Intergenic
1007857082 6:44868907-44868929 AGCTATGCTATCCCAATGGGTGG + Intronic
1008107316 6:47453280-47453302 AGCTGTGCTGTCAAAGTTGGTGG + Intergenic
1008596874 6:53051181-53051203 AGCTGTAGTTTAGAAATTGGTGG - Intronic
1014307202 6:119757766-119757788 AGCTGTTCCATCCCAATTGAAGG - Intergenic
1021686984 7:23195778-23195800 AGCTTTACTATCAAAATTATTGG + Intronic
1022803750 7:33801281-33801303 ATCTGCACTATCCAATATGGTGG - Intergenic
1026150701 7:67785963-67785985 AGCTGTAACACCCAAACTGGGGG + Intergenic
1037507813 8:19549839-19549861 AGCTGTACTTTCCAAATCTCAGG - Intronic
1038594549 8:28875210-28875232 TTCTGAACTATCCAAATAGGAGG + Intronic
1045612155 8:103857969-103857991 AGCTGTAATATCCAAAATCCAGG + Intronic
1048611765 8:136030724-136030746 GCCTGTTCTCTCCAAATTGGAGG + Intergenic
1050754490 9:8984388-8984410 AGCATAACTATCAAAATTGGAGG - Intronic
1050846017 9:10219572-10219594 AGCTTTGCTATCCAAATTACTGG - Intronic
1055767079 9:79674973-79674995 AGCTAGAAAATCCAAATTGGGGG - Intronic
1058862658 9:109131704-109131726 AGTTGAACCATCCAAATTCGGGG + Exonic
1060850953 9:126875056-126875078 ATCTGCACTATCCAGTTTGGTGG + Intronic
1185745526 X:2569667-2569689 ACTTGTGCTATCCAGATTGGGGG + Intergenic
1186233140 X:7477884-7477906 AGCTGAACTAACCAAATAAGAGG + Intergenic
1186299631 X:8185745-8185767 ATCTGTACTGTCCAATATGGTGG + Intergenic
1194544484 X:95215926-95215948 ACCTGTGCTTTCCAAATAGGTGG + Intergenic
1198813216 X:140557885-140557907 AGCTGTACTGTTCAATGTGGTGG + Intergenic