ID: 1137454413

View in Genome Browser
Species Human (GRCh38)
Location 16:48607532-48607554
Sequence CTCTAACACAAGTTGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137454409_1137454413 12 Left 1137454409 16:48607497-48607519 CCAGGGCAGGAGAATGACTTTTT 0: 1
1: 0
2: 2
3: 32
4: 428
Right 1137454413 16:48607532-48607554 CTCTAACACAAGTTGAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137454413 Original CRISPR CTCTAACACAAGTTGAACCA GGG Intronic
905435900 1:37954960-37954982 CTCCAGCACAAGTTGACCCCAGG + Intergenic
908072738 1:60481280-60481302 CTGTAACAGAAGATGAAACATGG - Intergenic
922240043 1:223749350-223749372 ATCTAAAACAAGTAAAACCAGGG - Intronic
924335605 1:242984155-242984177 CTCTAACACAAAATTACCCATGG - Intergenic
1063414372 10:5861507-5861529 TTCTAACATAAGGCGAACCATGG + Intergenic
1063687249 10:8248815-8248837 CTCTCAAACATGTTGAATCATGG + Intergenic
1063851367 10:10195644-10195666 ATCTAACTCAAGTTTGACCATGG - Intergenic
1068399792 10:56513519-56513541 CACATACACAAGTTGGACCAGGG - Intergenic
1068683562 10:59845843-59845865 CCCTAACACAGGGAGAACCAAGG + Intronic
1070580129 10:77712839-77712861 CTCTATCCCAAGTTGAATTAGGG - Intergenic
1070612506 10:77943255-77943277 CTCTAACAGAGGTGGAAGCACGG - Intergenic
1070982587 10:80661420-80661442 CTCTCACACAAGAGGAGCCAAGG + Intergenic
1078664309 11:13311785-13311807 CTCTGCCACAACTTGCACCACGG + Intronic
1082713382 11:56582710-56582732 TTCAAACACAAGTTGAACAGGGG + Intergenic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1098973873 12:76881790-76881812 TCCTAAGGCAAGTTGAACCAAGG + Intergenic
1102229165 12:111250408-111250430 CTCTAAAACAAGAGGACCCAGGG + Intronic
1106479150 13:30123846-30123868 CCCTGACACAGGTGGAACCAGGG - Intergenic
1106838350 13:33660145-33660167 CTCCAGCACAAGCAGAACCATGG + Intergenic
1106878972 13:34108263-34108285 CTGTAAAAGAAGTTAAACCAAGG - Intergenic
1109888371 13:68574127-68574149 CTGTAACAGGAGTTGAAACATGG + Intergenic
1113044208 13:106137134-106137156 CTGTAACAGAAGATGAAACATGG - Intergenic
1117860176 14:60082084-60082106 TTCTGACACATGTTGCACCATGG - Intergenic
1121892795 14:97611930-97611952 TTTTAAAACAAATTGAACCAAGG - Intergenic
1123140650 14:106074069-106074091 CTCTAACACAAGAAGAGCAAAGG - Intergenic
1123700119 15:22908094-22908116 CTCTATCACAATTTGAACACAGG - Intronic
1128764134 15:70240761-70240783 CTCTAACATGAGCTGAACCTTGG + Intergenic
1131899936 15:97076988-97077010 CTGTAAAACAAGAAGAACCAGGG - Intergenic
1133632502 16:7634752-7634774 CTGTGACACAATTTGAACTAGGG - Intronic
1135718855 16:24796944-24796966 CTCTAGCAGAAGTTGAACCTGGG - Intronic
1137454413 16:48607532-48607554 CTCTAACACAAGTTGAACCAGGG + Intronic
1140120677 16:72080638-72080660 CTCTCACAGAAGTAGAATCAGGG + Intronic
1147031182 17:37638032-37638054 CTGTAACAGAAGATGAAACATGG + Intronic
1156934805 18:42690742-42690764 ATCTGAGACAAGTTTAACCAGGG + Intergenic
1158447773 18:57536152-57536174 CTCAAAAATAAGTTTAACCAGGG + Intergenic
1159245181 18:65796601-65796623 CTACAAAACAGGTTGAACCAAGG - Intronic
925512313 2:4641585-4641607 CTCTTTCACAAGAAGAACCATGG - Intergenic
925930912 2:8707059-8707081 CATTAAAACAGGTTGAACCAAGG + Intergenic
927862956 2:26571400-26571422 CTCCAACCCAAGTGGGACCATGG - Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
931049254 2:58392263-58392285 CACTAACACATGTTGATCAAAGG - Intergenic
936780145 2:116022591-116022613 ATCTGATACAAATTGAACCATGG - Intergenic
946532962 2:220593123-220593145 CTTTAACACAAGTTGGAAAATGG + Intergenic
1171234252 20:23511352-23511374 CTGTATCACAAGTTGAACATAGG - Intergenic
1173722109 20:45268603-45268625 CTCTCACAAGGGTTGAACCAAGG + Intergenic
1174066756 20:47871461-47871483 CTCTCACCTAAGTTGAACCTTGG + Intergenic
1174289866 20:49500435-49500457 CTAGAATACAAGTTAAACCATGG + Intergenic
1174931147 20:54816348-54816370 CTTTAACACAAATTGAAAAATGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178789438 21:35686273-35686295 CTGTAACAGAAGATGAAACATGG + Intronic
1184574152 22:45348670-45348692 ATCTAAAACAAGTTGATTCAGGG - Intronic
957853348 3:85840641-85840663 CACTAACACAAAATGAACAATGG - Intronic
960655698 3:120001622-120001644 GACTAACACAAGTTGCAACATGG + Intronic
961315348 3:126031818-126031840 CTCTAACACAAGGTCTAGCAAGG - Intronic
964012898 3:151912310-151912332 CTCTAACACAGGATTAACCAAGG + Intergenic
966125022 3:176565904-176565926 ATCTATCACAAGTAGAACCCTGG + Intergenic
973476986 4:50909772-50909794 AACTAACAGAAGTTGAACCTTGG + Intergenic
975110384 4:70616935-70616957 CTCTAACACAGGCTGAGACAAGG + Intergenic
975484662 4:74922298-74922320 CTCAAGGACAAGTGGAACCAGGG + Intergenic
976713146 4:88094660-88094682 CTATAACACAAGTGGGAGCAGGG + Intronic
977176312 4:93824609-93824631 CTCTATTCCAAGGTGAACCAAGG - Intergenic
978457439 4:108909608-108909630 CTACAACACAATTTGAACAAAGG + Intronic
980935519 4:139221980-139222002 CCATAACACAATTTAAACCATGG - Intergenic
982046203 4:151448614-151448636 TTCTGACACATGTTAAACCATGG - Intronic
995577813 5:113559792-113559814 TTGTAACAGAAGATGAACCATGG + Intronic
997640419 5:135445256-135445278 CTCTAACTCAAGCAGAACCCTGG - Exonic
998499083 5:142616307-142616329 CTCCAACACTAGTTGAAACCAGG - Intronic
1000387002 5:160684086-160684108 CACTTACACAAGTTAAAACAAGG + Intronic
1000574323 5:162957488-162957510 TTTTAAGACTAGTTGAACCATGG - Intergenic
1004484252 6:16050927-16050949 CTCTAACAGAAGTTGAAACCAGG - Intergenic
1010350220 6:74864698-74864720 CCCTAAATCAAGTTGGACCAGGG - Intergenic
1014623138 6:123694091-123694113 CTCTAACACATTTTGACCAAGGG - Intergenic
1017913774 6:158817494-158817516 CTCTAACAGAAGGTTAGCCATGG - Intronic
1022984556 7:35638634-35638656 GTCTTACATAAGTTGACCCAGGG + Intronic
1024365029 7:48510461-48510483 CTCCCACACACGTAGAACCAAGG - Intronic
1028242230 7:88435439-88435461 CACTCACACAGGTTGAACCCGGG + Intergenic
1028509313 7:91605459-91605481 CTGTAACAGAAGATGAAGCATGG - Intergenic
1028951118 7:96636196-96636218 ATATAACACAAGGTGAAGCAAGG + Intronic
1029945667 7:104530059-104530081 TTCCAACAGAAGTTGTACCAAGG - Intronic
1032119119 7:129143998-129144020 AACTAATACAAGTTGAACCTCGG - Intergenic
1032244785 7:130201588-130201610 CTTTAAAACAAGTTGAAACAAGG - Intronic
1033726764 7:144127024-144127046 CTCTAAAACAATTTTATCCAGGG + Intergenic
1036106874 8:5850366-5850388 CTCTAACAAAACTTGAGTCATGG - Intergenic
1039402806 8:37285606-37285628 CTGTAACAGAAGATGAAACATGG + Intergenic
1050885963 9:10765496-10765518 CTCTTTTACAAATTGAACCAAGG - Intergenic
1056008118 9:82295664-82295686 CTTTAGCACAAGTTGAAACCAGG + Intergenic
1187102165 X:16204788-16204810 TTCTGGCACAAGTTCAACCAAGG + Intergenic
1195438079 X:104868186-104868208 CTCAGACACAAGTAGAACAATGG + Intronic