ID: 1137454725

View in Genome Browser
Species Human (GRCh38)
Location 16:48609732-48609754
Sequence CGCGCGCCCGCGGCCTCGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137454725_1137454733 -9 Left 1137454725 16:48609732-48609754 CCGATCGAGGCCGCGGGCGCGCG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG 0: 2
1: 2
2: 53
3: 318
4: 1861
1137454725_1137454734 2 Left 1137454725 16:48609732-48609754 CCGATCGAGGCCGCGGGCGCGCG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1137454734 16:48609757-48609779 GGCGGCGGCCGGACTCACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137454725 Original CRISPR CGCGCGCCCGCGGCCTCGAT CGG (reversed) Intronic