ID: 1137454725

View in Genome Browser
Species Human (GRCh38)
Location 16:48609732-48609754
Sequence CGCGCGCCCGCGGCCTCGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137454725_1137454733 -9 Left 1137454725 16:48609732-48609754 CCGATCGAGGCCGCGGGCGCGCG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG 0: 2
1: 2
2: 53
3: 318
4: 1861
1137454725_1137454734 2 Left 1137454725 16:48609732-48609754 CCGATCGAGGCCGCGGGCGCGCG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1137454734 16:48609757-48609779 GGCGGCGGCCGGACTCACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137454725 Original CRISPR CGCGCGCCCGCGGCCTCGAT CGG (reversed) Intronic
922505270 1:226122275-226122297 CGCGAGCCGGCGGCCCCGAGAGG - Intergenic
1065367898 10:24952777-24952799 CGCGCCCCCGCGGCCTAGCCAGG - Intergenic
1072903580 10:99430671-99430693 GGCGGGCCCGCGGCCTCCAATGG + Intergenic
1074121724 10:110498320-110498342 CGCGCGCGCGCCGCCTCGTCGGG - Exonic
1076710591 10:132331818-132331840 TCCGCGCCCGCGGCCTTGAAGGG - Intronic
1076722054 10:132397064-132397086 CGCGCGCCCCCGGCCCGGCTCGG + Intergenic
1076833334 10:133007728-133007750 CCCACCCCCGCGGCCTCTATTGG + Intergenic
1077476340 11:2792155-2792177 CGCACTCCCGCGGCCTCCAGGGG + Intronic
1083753747 11:64778223-64778245 CCCCCGCCCGTGGGCTCGATGGG - Exonic
1095584570 12:43836112-43836134 GGCGCGCCGGCGGCCTCGCTGGG - Exonic
1100315476 12:93441488-93441510 CGCGCGCCCGCGGCCTCCGGCGG + Intronic
1121101549 14:91253502-91253524 CACGCCCCGGCGGCCTCGCTTGG + Intronic
1122418355 14:101560923-101560945 CGCTGGCCCGCGTCCTCGGTGGG + Intergenic
1122736661 14:103847474-103847496 AGCGCGCCGGCGGCCGCGACAGG - Exonic
1122842748 14:104474397-104474419 GCCGAGCCCGCGGCCTCTATAGG - Intergenic
1127439089 15:58988095-58988117 CGCGCACGCGCGGCCTCCAATGG - Intronic
1132186653 15:99806856-99806878 CGCGCGGCGGCGGCCTCGCAGGG + Intergenic
1132429034 15:101745855-101745877 CGCGCGGCGGCGGCCTCGCAGGG - Intergenic
1136779090 16:32885936-32885958 CCCGCGCCCCCGGCCCCGACCGG + Intergenic
1137454725 16:48609732-48609754 CGCGCGCCCGCGGCCTCGATCGG - Intronic
1140478822 16:75251730-75251752 TGCGCGCCCGCGCCCCCGACAGG - Intronic
1147123651 17:38351742-38351764 CGCGCGCCCCCGGCCCCTATTGG - Intergenic
1151579916 17:74972089-74972111 TGCGCGGCAGCGGCCTCGCTGGG - Intronic
1160763698 19:797935-797957 CGCGCGTGCGCGGCCGCCATCGG + Intronic
1160961870 19:1725733-1725755 CGCGGGGCCGCGGGATCGATCGG + Intergenic
1161304081 19:3557399-3557421 CGCGGGCCCGGCGCCGCGATGGG - Exonic
1166808093 19:45498860-45498882 CGCACGCCCTCGGGCTCGCTAGG - Exonic
1166852743 19:45768308-45768330 CGCGCGGCCGCGGGCCCGCTCGG + Exonic
1166975096 19:46601247-46601269 CGCGCGCGCCCCGCCTCGCTCGG - Exonic
1168064005 19:53909323-53909345 CCCGCGGCCGCGGCCTCACTCGG - Exonic
931711003 2:64989168-64989190 CGCGCCCCCGCGGCCTCGGGTGG + Intronic
936427325 2:112432940-112432962 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427379 2:112433118-112433140 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427405 2:112433208-112433230 GGCCCGGCGGCGGCCTCGATGGG - Intronic
936427432 2:112433298-112433320 GGCCCGGCGGCGGCCTCGATGGG - Intronic
942314092 2:174682582-174682604 CGCGGGCGCGCGGCCTCGGGAGG - Intronic
948910070 2:240998499-240998521 CGCGCGCCCGCGCCCTCCCACGG + Intergenic
1172064228 20:32207807-32207829 CGCCCGCCCGCGGGCTAGAGCGG + Intergenic
1173649165 20:44651911-44651933 CGCGCTCCAGCCGCCTCGCTGGG + Intronic
1175997234 20:62817294-62817316 CGTCCGGCCGCGTCCTCGATGGG + Intronic
1176550731 21:8219711-8219733 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1176550863 21:8220507-8220529 CACGCGCCCGCGACCTCCACCGG + Intergenic
1176569661 21:8402774-8402796 CACGCGCCCGCGACCTCCACCGG + Intergenic
1176577573 21:8446981-8447003 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1181162053 22:20965155-20965177 CCCGCGCCCGCGGCCCCAAGCGG + Exonic
1181270783 22:21657481-21657503 CGCGCGCTCACGACCTCGAGGGG - Intronic
1182278634 22:29205854-29205876 CGCGCGCTCCCGGCCTCGCCCGG - Exonic
1183942135 22:41301898-41301920 CGCGCGGCCCCGGCCTGGAAAGG - Intronic
1203255632 22_KI270733v1_random:136054-136076 CGCGCGCCCGCGACCTCCACCGG + Intergenic
1203255766 22_KI270733v1_random:136831-136853 CACGCGCCCGCGACCTCCACCGG + Intergenic
1203255875 22_KI270733v1_random:137516-137538 CACGCGCCCGCGACCTCCACCGG + Intergenic
953246535 3:41199193-41199215 CGGGCCCCCGCGGCCTGGGTTGG - Intronic
968010525 3:195271188-195271210 CGCGCACCGGCGCCCGCGATTGG - Intergenic
977176766 4:93828626-93828648 CGCCTGCCCGCGCCCTCCATTGG + Intergenic
982198368 4:152937217-152937239 CCCGCGCCTGCGACCTGGATGGG + Intronic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
988796342 5:34656453-34656475 AGCGCCGCCGCCGCCTCGATGGG + Intronic
998131263 5:139652132-139652154 CGCGCGCCGGCGGCTAGGATGGG - Intronic
998288231 5:140884447-140884469 GGCGCGCACGCGCCCTCGGTGGG - Exonic
999169494 5:149581478-149581500 CGCCCGCCAGCGCCCTCGGTGGG + Exonic
1002185941 5:177454858-177454880 CGCGCGCCCGCCGGCGCCATGGG + Exonic
1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG + Intergenic
1004396164 6:15248272-15248294 CGCGCGCGCGCGGCCTATAGGGG + Intronic
1012510211 6:99993602-99993624 CGCGCTCCAGCGGTCTCGGTCGG + Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1029098318 7:98106876-98106898 CGCGCTCCCGCCGCCATGATGGG - Exonic
1030093338 7:105876702-105876724 CGCGCGCCCGCGGCCGCCAGGGG + Intergenic
1038643859 8:29348172-29348194 GGCGCGCCCGCGCTCTCCATCGG + Intronic
1042785028 8:72537164-72537186 CGCGCACCCGCGGGCTGGAGCGG - Intergenic
1057245614 9:93451898-93451920 CGCGCCCCCGCCGCCGCCATGGG + Exonic
1060897273 9:127225640-127225662 CGCACGCCCGCGGCTTCGGCGGG + Intronic
1061975952 9:134068116-134068138 CGCGCGCCCGCGGCCTCCCCTGG - Intronic
1203472029 Un_GL000220v1:119189-119211 CACGCGCCCGCGACCTCCACCGG + Intergenic