ID: 1137454790

View in Genome Browser
Species Human (GRCh38)
Location 16:48610006-48610028
Sequence TGAGGGGGCGTCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137454790_1137454800 17 Left 1137454790 16:48610006-48610028 CCGGCGGCGGCGACGCCCCCTCA 0: 1
1: 0
2: 3
3: 7
4: 118
Right 1137454800 16:48610046-48610068 CCAAGCCAGTCAGGCGGCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 171
1137454790_1137454797 11 Left 1137454790 16:48610006-48610028 CCGGCGGCGGCGACGCCCCCTCA 0: 1
1: 0
2: 3
3: 7
4: 118
Right 1137454797 16:48610040-48610062 CTGCTCCCAAGCCAGTCAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 208
1137454790_1137454796 8 Left 1137454790 16:48610006-48610028 CCGGCGGCGGCGACGCCCCCTCA 0: 1
1: 0
2: 3
3: 7
4: 118
Right 1137454796 16:48610037-48610059 CCGCTGCTCCCAAGCCAGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 164
1137454790_1137454802 27 Left 1137454790 16:48610006-48610028 CCGGCGGCGGCGACGCCCCCTCA 0: 1
1: 0
2: 3
3: 7
4: 118
Right 1137454802 16:48610056-48610078 CAGGCGGCGTCGGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137454790 Original CRISPR TGAGGGGGCGTCGCCGCCGC CGG (reversed) Exonic
900428801 1:2592479-2592501 GGAGGGGGCGTCAGCGCGGCAGG - Intronic
900428809 1:2592502-2592524 GGAGGGGGCGTCAGCGCGGCAGG - Intronic
900428842 1:2592594-2592616 GGAGGGGGCGTCAGCGCGGCAGG - Intronic
900428850 1:2592617-2592639 GGAGGGGGCGTCAGCGCGGCAGG - Intronic
900678219 1:3901389-3901411 GGAGGAGGCGTGGCCGCTGCGGG - Intergenic
902410043 1:16207088-16207110 GGAGGGGCCGGGGCCGCCGCGGG - Exonic
902916701 1:19644143-19644165 GGAGGGGGCGCCGCGGCGGCAGG - Intronic
905414327 1:37794188-37794210 TGCAGGCGCGGCGCCGCCGCCGG - Exonic
910788000 1:91021665-91021687 TGAGCGGCGGCCGCCGCCGCGGG - Intronic
910981303 1:92961762-92961784 GGAGGGGGCGCCGCGGCAGCGGG + Intergenic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
1063676025 10:8141245-8141267 TGAGGGAGAGTGGCCTCCGCTGG + Intergenic
1064167686 10:13001168-13001190 AGAGGTGGCGGCGGCGCCGCCGG + Intronic
1064202952 10:13299911-13299933 TCAGGCGGCGGCGCCGGCGCCGG + Intronic
1072473285 10:95734079-95734101 TGAGGGGGCTTTGCCTCAGCTGG - Intronic
1073498890 10:103918368-103918390 GGATGGGGCGTGGCCGCGGCGGG - Intergenic
1075075251 10:119346236-119346258 TGAGGCAGCATCGCCGCAGCGGG + Intronic
1076675045 10:132143164-132143186 GGAGGGGGCGTCCCCTCCTCAGG + Intronic
1076694996 10:132243091-132243113 TGAGGGGAGGTCGCTGCCCCAGG - Intronic
1077021074 11:417402-417424 TGCCGGGGCTACGCCGCCGCCGG - Intronic
1080037292 11:27722635-27722657 TGCGGGGGCTGCCCCGCCGCCGG + Intergenic
1084485090 11:69443497-69443519 TGATTGGGCGTCGCGGCCGGGGG + Intergenic
1084694117 11:70743856-70743878 TGTGGGGGTGTCGCAGCAGCCGG - Intronic
1084960231 11:72712625-72712647 AGAGGGGGCGTGGCAGCCCCGGG - Intronic
1088522141 11:110711936-110711958 GGAGGCGGCGGCGCTGCCGCTGG + Intronic
1096178708 12:49539228-49539250 CGAGGGGGCGTCCGCGCCGTCGG - Exonic
1103649636 12:122422629-122422651 TGACGCGCCGCCGCCGCCGCGGG + Intronic
1105413901 13:20193013-20193035 GGAGGGGGCGGCGCCGCGGGCGG + Intergenic
1105512126 13:21060607-21060629 TGAGCCGGCGGCGCGGCCGCGGG + Intronic
1108541614 13:51452131-51452153 TGTGGGGGCGGCGGGGCCGCTGG - Intronic
1114612523 14:24052104-24052126 AGAGGAGCCGCCGCCGCCGCCGG - Exonic
1118404664 14:65412072-65412094 AGAGGGGCTGTCGCAGCCGCGGG + Intronic
1120993575 14:90398190-90398212 GGAGGAGGCGGCGGCGCCGCGGG + Intronic
1121137232 14:91510014-91510036 TGAGGAGGCGGCGGCGGCGCGGG - Exonic
1122226837 14:100285392-100285414 GCAGGGTGCGCCGCCGCCGCCGG + Intergenic
1124453869 15:29822549-29822571 GGAGGGGGCGGGGCCGCGGCGGG + Intronic
1125677860 15:41512075-41512097 GGATGGGGCGGCGCCGGCGCCGG - Intronic
1125685104 15:41559239-41559261 TGGTGCGGCGTCGCCGCCGATGG + Exonic
1132251964 15:100341290-100341312 TGCGGGGGCGTCGCCGCCGTCGG + Exonic
1136547866 16:30965664-30965686 TGAGGGGGCGTCGGGGCCGGAGG - Exonic
1137454790 16:48610006-48610028 TGAGGGGGCGTCGCCGCCGCCGG - Exonic
1139387128 16:66579801-66579823 GGAGGGGGTGTCGCCGCTACCGG + Exonic
1141531372 16:84648823-84648845 GGAGGGGCCGCCGCCCCCGCAGG + Intronic
1144501078 17:15786899-15786921 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1145163245 17:20589573-20589595 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1146283320 17:31559112-31559134 GGAGCGGGCGTCGCGGCCGGGGG + Intergenic
1146646628 17:34580896-34580918 GGAGGGGGCGTCCCAGGCGCTGG - Exonic
1147719804 17:42532121-42532143 TGGAGAGGCGCCGCCGCCGCCGG + Intergenic
1150675806 17:67245259-67245281 GGAGGGGGCGGCGCCGGCGGCGG - Intronic
1151780214 17:76240463-76240485 TGAGGCGGCGGCGGCGCCCCCGG - Intergenic
1152627997 17:81397001-81397023 GGTGGCGGCGTCGCCGCTGCGGG + Intronic
1156316356 18:35972506-35972528 TGAGGGGGCGGGGACGCGGCGGG + Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1161510938 19:4670515-4670537 CGAGGGGGCGGGGCCGCCGAGGG + Intergenic
1161510947 19:4670532-4670554 CGAGGGGGCGGGGCCGCCGAGGG + Intergenic
1162235910 19:9309606-9309628 TGAGGAGGCGCCGCGGCGGCGGG + Intronic
1162373922 19:10294173-10294195 TGAGGGGGTGCTGCTGCCGCTGG + Exonic
1162745180 19:12793885-12793907 GGAGGGGGCGTGGGCGCGGCGGG - Intronic
1163177809 19:15576730-15576752 TGAGGGTGCGACGCCGCTCCTGG - Intergenic
1163183934 19:15623270-15623292 TGAGGGTGCGGCGCCGCTCCTGG - Exonic
1163519093 19:17781349-17781371 TGAGGGGGCGTGGCAGGAGCTGG + Intronic
1163557601 19:18001413-18001435 GGAGGCGGCGGCGCCGCTGCGGG + Intronic
1163609037 19:18291754-18291776 TGCGGGGTCCTCTCCGCCGCCGG + Intergenic
1163847041 19:19643653-19643675 TGCGGGGGCGTGGCCTCCGCTGG - Exonic
1166524739 19:43504073-43504095 GGAGGGGACCCCGCCGCCGCTGG - Exonic
1168233740 19:55049038-55049060 TGAGGGTGGGCCGCCCCCGCTGG + Intronic
934754652 2:96816661-96816683 TGAGGAGGCGGCGCCGCCCTGGG + Exonic
934846374 2:97663717-97663739 TGCGTGGCCGTCGCCCCCGCCGG - Intronic
935301521 2:101697617-101697639 GGAGGGGGCGGCGGCGGCGCTGG - Intronic
945251695 2:207769951-207769973 TGAGGGGGCGGAGCCGGGGCGGG - Intergenic
1169277409 20:4243241-4243263 AGAGGGGGCGTGGCTGCGGCGGG - Intronic
1175862674 20:62158635-62158657 TGAGCGGGCGCTGCCGACGCGGG - Intronic
1176310840 21:5148050-5148072 CGAGGCTGCGTCCCCGCCGCAGG - Intronic
1176548359 21:8211520-8211542 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176567290 21:8394555-8394577 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176882622 21:14216090-14216112 TGAGGGGGCGGGGCCGGCGCCGG - Intergenic
1179794604 21:43775845-43775867 TGATCGGGCGTCGCCGGCGATGG - Intronic
1179846215 21:44113985-44114007 CGAGGCTGCGTCCCCGCCGCAGG + Intronic
1180014695 21:45074550-45074572 GGAGGGGGCGGAGCCGCCGGCGG + Intronic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181381581 22:22508729-22508751 TGAGGAGGCGTAGTCGCCGCCGG - Exonic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1183780235 22:39994839-39994861 GGAGGGGCCGCCGCCTCCGCCGG - Intergenic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1184361955 22:44024250-44024272 CGAGGGCGCGGCCCCGCCGCCGG - Intronic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
955182282 3:56683276-56683298 GGAGGGGGCGGGGCCACCGCGGG + Intergenic
962277959 3:134030045-134030067 TGAGGGGGCGGCGGCGGCGGCGG - Exonic
968640602 4:1712585-1712607 TGAGGCGGCCGGGCCGCCGCGGG + Intergenic
969357751 4:6640545-6640567 TGCGGCCGCGACGCCGCCGCCGG + Exonic
969417175 4:7068326-7068348 TGAGGGGGCGGGGCCAGCGCCGG + Intergenic
969714579 4:8862051-8862073 CGCCGGGGCGTCGCCTCCGCTGG - Intronic
978361065 4:107931652-107931674 TCCGGGGCCGTCGCAGCCGCCGG + Exonic
984715036 4:182917383-182917405 GGAGGAGGCGGGGCCGCCGCGGG + Intronic
985542914 5:495094-495116 TGGGGGGGCGCCGTGGCCGCAGG + Intronic
985557644 5:565333-565355 TGAGGGGACGGCGCCGACACAGG + Intergenic
985557766 5:565765-565787 TGAGGGGACGGCGCCGACACAGG + Intergenic
985557781 5:565808-565830 TGAGGGGACGGCGCCGACACAGG + Intergenic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
997652887 5:135535460-135535482 AGAGGCGGCGGCGCCGCGGCCGG - Exonic
998149077 5:139746834-139746856 CGAGGGAGCGTCGCTGCCCCTGG - Intergenic
1002405085 5:179024086-179024108 GGAGGGCGCTTCGACGCCGCTGG + Intronic
1002927083 6:1610946-1610968 TGAAGCGCCGCCGCCGCCGCAGG - Exonic
1007902596 6:45424153-45424175 TGAGGGCGGGTGGCAGCCGCGGG + Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1014230086 6:118893942-118893964 GGAGGGGGCGTGGCCGCGGCGGG - Intronic
1014569836 6:122996022-122996044 TGAGCGGGCGTCGCCGGGCCAGG - Exonic
1014798303 6:125749579-125749601 GGGGGGGGCGTGGCCGGCGCCGG + Exonic
1019179313 6:170176803-170176825 TGAGTGGGCGGCCCCGCCTCCGG - Intergenic
1024576712 7:50770423-50770445 TGAGGGGGTGTTGCAGCCCCTGG + Intronic
1032230626 7:130070683-130070705 GGAGGAGGCGCCGCCGGCGCTGG + Exonic
1034441219 7:151086869-151086891 CGAGGGGCCGCCGCCGCCCCCGG - Exonic
1036454207 8:8893435-8893457 CGAGGAGGCGACGCCGCTGCCGG - Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1053001156 9:34577958-34577980 GGCGGGGGCGTCGCGGCGGCGGG + Intronic
1053129038 9:35605179-35605201 TGAGGGGGCGTGGCCGCTGCCGG + Intergenic
1057631112 9:96719837-96719859 TGATGGGGCGTCTGCGCGGCGGG + Intergenic
1057787094 9:98095547-98095569 TGAGGGGGTGTGGCCACCGCAGG + Intronic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1187281292 X:17860485-17860507 TGAGTGTGCGTCGGCGCCCCGGG - Intronic
1187933353 X:24313519-24313541 TGAGGGGTCGTCGTCGTGGCCGG + Intergenic
1187938874 X:24362535-24362557 TGAGGGGTCGTCGTCGTGGCCGG - Intergenic
1189247471 X:39574745-39574767 TGAGGGGGCTTAGCCACCGCAGG + Intergenic
1196717227 X:118823664-118823686 TGAGGGGGCGGGGGCGCAGCAGG - Intergenic
1196741290 X:119028432-119028454 TCAGTGGCCCTCGCCGCCGCGGG + Intergenic