ID: 1137457771

View in Genome Browser
Species Human (GRCh38)
Location 16:48631275-48631297
Sequence GGTCTAAAGAGTCTAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137457771_1137457772 -3 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457772 16:48631295-48631317 ACCTGTGCTATTTTATTGACTGG No data
1137457771_1137457775 19 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457775 16:48631317-48631339 GAGCCAAGCAGTGAAGCCCTGGG No data
1137457771_1137457780 30 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457780 16:48631328-48631350 TGAAGCCCTGGGTGGGGAGCTGG No data
1137457771_1137457777 22 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457777 16:48631320-48631342 CCAAGCAGTGAAGCCCTGGGTGG No data
1137457771_1137457774 18 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457774 16:48631316-48631338 GGAGCCAAGCAGTGAAGCCCTGG No data
1137457771_1137457779 24 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457779 16:48631322-48631344 AAGCAGTGAAGCCCTGGGTGGGG No data
1137457771_1137457778 23 Left 1137457771 16:48631275-48631297 CCAGATTTTAGACTCTTTAGACC No data
Right 1137457778 16:48631321-48631343 CAAGCAGTGAAGCCCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137457771 Original CRISPR GGTCTAAAGAGTCTAAAATC TGG (reversed) Intergenic
No off target data available for this crispr