ID: 1137458337

View in Genome Browser
Species Human (GRCh38)
Location 16:48635405-48635427
Sequence TGTCATGGAAGGCCACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137458337_1137458343 14 Left 1137458337 16:48635405-48635427 CCCTTAGGTGGCCTTCCATGACA No data
Right 1137458343 16:48635442-48635464 ACGCTTCCATCTCATTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137458337 Original CRISPR TGTCATGGAAGGCCACCTAA GGG (reversed) Intergenic
No off target data available for this crispr