ID: 1137459335

View in Genome Browser
Species Human (GRCh38)
Location 16:48645404-48645426
Sequence GCAAGTATTGATATTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137459335_1137459337 11 Left 1137459335 16:48645404-48645426 CCTGATTCAATATCAATACTTGC No data
Right 1137459337 16:48645438-48645460 TCAGACTTTCTGTTTCTTCTTGG No data
1137459335_1137459338 26 Left 1137459335 16:48645404-48645426 CCTGATTCAATATCAATACTTGC No data
Right 1137459338 16:48645453-48645475 CTTCTTGGTTCAATCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137459335 Original CRISPR GCAAGTATTGATATTGAATC AGG (reversed) Intergenic
No off target data available for this crispr