ID: 1137464102

View in Genome Browser
Species Human (GRCh38)
Location 16:48692375-48692397
Sequence AGGCTGTTCTAGCAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137464102_1137464108 19 Left 1137464102 16:48692375-48692397 CCCTGTCCCTGCTAGAACAGCCT No data
Right 1137464108 16:48692417-48692439 CTTCCCACTCCTCATTCAGGTGG No data
1137464102_1137464107 16 Left 1137464102 16:48692375-48692397 CCCTGTCCCTGCTAGAACAGCCT No data
Right 1137464107 16:48692414-48692436 TTACTTCCCACTCCTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137464102 Original CRISPR AGGCTGTTCTAGCAGGGACA GGG (reversed) Intergenic
No off target data available for this crispr