ID: 1137465056

View in Genome Browser
Species Human (GRCh38)
Location 16:48700243-48700265
Sequence CTCACTACCACCAACACTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137465056_1137465059 -10 Left 1137465056 16:48700243-48700265 CCGTAAGTGTTGGTGGTAGTGAG No data
Right 1137465059 16:48700256-48700278 TGGTAGTGAGGTTTGTGTCTGGG No data
1137465056_1137465061 11 Left 1137465056 16:48700243-48700265 CCGTAAGTGTTGGTGGTAGTGAG No data
Right 1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG No data
1137465056_1137465060 -9 Left 1137465056 16:48700243-48700265 CCGTAAGTGTTGGTGGTAGTGAG No data
Right 1137465060 16:48700257-48700279 GGTAGTGAGGTTTGTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137465056 Original CRISPR CTCACTACCACCAACACTTA CGG (reversed) Intergenic
No off target data available for this crispr