ID: 1137465061

View in Genome Browser
Species Human (GRCh38)
Location 16:48700277-48700299
Sequence GGGTCTGAAAGTGCATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137465056_1137465061 11 Left 1137465056 16:48700243-48700265 CCGTAAGTGTTGGTGGTAGTGAG No data
Right 1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137465061 Original CRISPR GGGTCTGAAAGTGCATCTTG AGG Intergenic
No off target data available for this crispr