ID: 1137465091

View in Genome Browser
Species Human (GRCh38)
Location 16:48700473-48700495
Sequence CCAAGGTTCCTGAAGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137465091_1137465099 -7 Left 1137465091 16:48700473-48700495 CCCAGACACTTCAGGAACCTTGG No data
Right 1137465099 16:48700489-48700511 ACCTTGGGAAAAGGGTAGGGAGG No data
1137465091_1137465101 -6 Left 1137465091 16:48700473-48700495 CCCAGACACTTCAGGAACCTTGG No data
Right 1137465101 16:48700490-48700512 CCTTGGGAAAAGGGTAGGGAGGG No data
1137465091_1137465098 -10 Left 1137465091 16:48700473-48700495 CCCAGACACTTCAGGAACCTTGG No data
Right 1137465098 16:48700486-48700508 GGAACCTTGGGAAAAGGGTAGGG No data
1137465091_1137465102 4 Left 1137465091 16:48700473-48700495 CCCAGACACTTCAGGAACCTTGG No data
Right 1137465102 16:48700500-48700522 AGGGTAGGGAGGGCTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137465091 Original CRISPR CCAAGGTTCCTGAAGTGTCT GGG (reversed) Intergenic
No off target data available for this crispr