ID: 1137468031

View in Genome Browser
Species Human (GRCh38)
Location 16:48729037-48729059
Sequence ATGTTTGAGAAGCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137468031_1137468034 -1 Left 1137468031 16:48729037-48729059 CCTCCCTGCTGCTTCTCAAACAT No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137468031 Original CRISPR ATGTTTGAGAAGCAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr