ID: 1137468034

View in Genome Browser
Species Human (GRCh38)
Location 16:48729059-48729081
Sequence TGCTAAGCCCATCCTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137468031_1137468034 -1 Left 1137468031 16:48729037-48729059 CCTCCCTGCTGCTTCTCAAACAT No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468027_1137468034 30 Left 1137468027 16:48729006-48729028 CCCTCTTGTCCACTCTACTCCAG No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468032_1137468034 -4 Left 1137468032 16:48729040-48729062 CCCTGCTGCTTCTCAAACATGCT No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468030_1137468034 11 Left 1137468030 16:48729025-48729047 CCAGCACACTGACCTCCCTGCTG No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468033_1137468034 -5 Left 1137468033 16:48729041-48729063 CCTGCTGCTTCTCAAACATGCTA No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468029_1137468034 21 Left 1137468029 16:48729015-48729037 CCACTCTACTCCAGCACACTGAC No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data
1137468028_1137468034 29 Left 1137468028 16:48729007-48729029 CCTCTTGTCCACTCTACTCCAGC No data
Right 1137468034 16:48729059-48729081 TGCTAAGCCCATCCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137468034 Original CRISPR TGCTAAGCCCATCCTGCTCT AGG Intergenic
No off target data available for this crispr