ID: 1137468243

View in Genome Browser
Species Human (GRCh38)
Location 16:48730750-48730772
Sequence CTAATGCTGTACCATACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137468241_1137468243 27 Left 1137468241 16:48730700-48730722 CCTTATGCAGCTCTTGCACAGTG No data
Right 1137468243 16:48730750-48730772 CTAATGCTGTACCATACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137468243 Original CRISPR CTAATGCTGTACCATACACC AGG Intergenic
No off target data available for this crispr