ID: 1137468244

View in Genome Browser
Species Human (GRCh38)
Location 16:48730751-48730773
Sequence TAATGCTGTACCATACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137468241_1137468244 28 Left 1137468241 16:48730700-48730722 CCTTATGCAGCTCTTGCACAGTG No data
Right 1137468244 16:48730751-48730773 TAATGCTGTACCATACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137468244 Original CRISPR TAATGCTGTACCATACACCA GGG Intergenic
No off target data available for this crispr