ID: 1137481675

View in Genome Browser
Species Human (GRCh38)
Location 16:48856965-48856987
Sequence GTGTGCATGGGGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137481669_1137481675 15 Left 1137481669 16:48856927-48856949 CCTATCACAAACAATCTGGGGAG No data
Right 1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137481675 Original CRISPR GTGTGCATGGGGAAGATGGA AGG Intergenic
No off target data available for this crispr