ID: 1137481705

View in Genome Browser
Species Human (GRCh38)
Location 16:48857285-48857307
Sequence CCATCCTACTGAGGGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137481694_1137481705 24 Left 1137481694 16:48857238-48857260 CCAGGAACCATCCCTCAGGCTCA No data
Right 1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG No data
1137481696_1137481705 17 Left 1137481696 16:48857245-48857267 CCATCCCTCAGGCTCAGGCAAAA No data
Right 1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG No data
1137481697_1137481705 13 Left 1137481697 16:48857249-48857271 CCCTCAGGCTCAGGCAAAACATC No data
Right 1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG No data
1137481699_1137481705 -9 Left 1137481699 16:48857271-48857293 CCTATGTTTCCTTCCCATCCTAC No data
Right 1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG No data
1137481698_1137481705 12 Left 1137481698 16:48857250-48857272 CCTCAGGCTCAGGCAAAACATCC No data
Right 1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137481705 Original CRISPR CCATCCTACTGAGGGAAAAT AGG Intergenic
No off target data available for this crispr