ID: 1137481984

View in Genome Browser
Species Human (GRCh38)
Location 16:48859451-48859473
Sequence GCTTCATCAAGGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137481984_1137481995 18 Left 1137481984 16:48859451-48859473 CCTCCCAGCCTCCTTGATGAAGC No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481984_1137481994 17 Left 1137481984 16:48859451-48859473 CCTCCCAGCCTCCTTGATGAAGC No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137481984 Original CRISPR GCTTCATCAAGGAGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr