ID: 1137481994

View in Genome Browser
Species Human (GRCh38)
Location 16:48859491-48859513
Sequence TGCCAGCTCCCATGTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137481989_1137481994 9 Left 1137481989 16:48859459-48859481 CCTCCTTGATGAAGCAGGGAATG No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481992_1137481994 6 Left 1137481992 16:48859462-48859484 CCTTGATGAAGCAGGGAATGGGT No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481987_1137481994 13 Left 1137481987 16:48859455-48859477 CCAGCCTCCTTGATGAAGCAGGG No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481985_1137481994 14 Left 1137481985 16:48859454-48859476 CCCAGCCTCCTTGATGAAGCAGG No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481984_1137481994 17 Left 1137481984 16:48859451-48859473 CCTCCCAGCCTCCTTGATGAAGC No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481981_1137481994 29 Left 1137481981 16:48859439-48859461 CCTTTCCTTTACCCTCCCAGCCT No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481982_1137481994 24 Left 1137481982 16:48859444-48859466 CCTTTACCCTCCCAGCCTCCTTG No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data
1137481983_1137481994 18 Left 1137481983 16:48859450-48859472 CCCTCCCAGCCTCCTTGATGAAG No data
Right 1137481994 16:48859491-48859513 TGCCAGCTCCCATGTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137481994 Original CRISPR TGCCAGCTCCCATGTCTGCC TGG Intergenic
No off target data available for this crispr