ID: 1137481995

View in Genome Browser
Species Human (GRCh38)
Location 16:48859492-48859514
Sequence GCCAGCTCCCATGTCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137481992_1137481995 7 Left 1137481992 16:48859462-48859484 CCTTGATGAAGCAGGGAATGGGT No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481983_1137481995 19 Left 1137481983 16:48859450-48859472 CCCTCCCAGCCTCCTTGATGAAG No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481989_1137481995 10 Left 1137481989 16:48859459-48859481 CCTCCTTGATGAAGCAGGGAATG No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481987_1137481995 14 Left 1137481987 16:48859455-48859477 CCAGCCTCCTTGATGAAGCAGGG No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481984_1137481995 18 Left 1137481984 16:48859451-48859473 CCTCCCAGCCTCCTTGATGAAGC No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481985_1137481995 15 Left 1137481985 16:48859454-48859476 CCCAGCCTCCTTGATGAAGCAGG No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481981_1137481995 30 Left 1137481981 16:48859439-48859461 CCTTTCCTTTACCCTCCCAGCCT No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data
1137481982_1137481995 25 Left 1137481982 16:48859444-48859466 CCTTTACCCTCCCAGCCTCCTTG No data
Right 1137481995 16:48859492-48859514 GCCAGCTCCCATGTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137481995 Original CRISPR GCCAGCTCCCATGTCTGCCT GGG Intergenic
No off target data available for this crispr