ID: 1137482370

View in Genome Browser
Species Human (GRCh38)
Location 16:48863273-48863295
Sequence AGGGGAGGATGTGACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 2, 1: 0, 2: 6, 3: 28, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137482368_1137482370 -7 Left 1137482368 16:48863257-48863279 CCAGGGGTTGGGTGTTAGGGGAG No data
Right 1137482370 16:48863273-48863295 AGGGGAGGATGTGACTGTAAAGG 0: 2
1: 0
2: 6
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137482370 Original CRISPR AGGGGAGGATGTGACTGTAA AGG Intergenic
900696721 1:4016880-4016902 AGGGGAGGAGGTGAGAGTCAGGG + Intergenic
900696803 1:4017089-4017111 AGGGGAGGAGGTGAGAGTCAGGG + Intergenic
902735551 1:18398499-18398521 TGGGGAGGCTGTCATTGTAATGG + Intergenic
902867197 1:19287598-19287620 AGGGGAGGATGTGTGTATAGGGG - Intronic
903362928 1:22788298-22788320 AGGGGAAGATGAGAGTGGAAGGG - Intronic
905250992 1:36648266-36648288 AGTGGAGCATGTGACTGTGTGGG - Intergenic
906959673 1:50411353-50411375 GGGGGAGGATTTGATTATAAAGG + Intergenic
907980790 1:59478803-59478825 AGAGGAAGATGTGCCTGCAAAGG + Intronic
908621394 1:65984326-65984348 CAGGAAGGATGTGACTATAAAGG + Intronic
908779495 1:67676615-67676637 AGGGGAGGAAGTGTCTTTAAAGG + Intergenic
910865522 1:91784844-91784866 AGTGGAAGATGAGACTGGAAAGG - Intronic
916087267 1:161280571-161280593 AGGGGAGGGCATGATTGTAATGG - Intronic
916693793 1:167217037-167217059 AGGGGAAGATGTGATTATAAGGG - Intergenic
917863234 1:179168728-179168750 GGAAGAGGATGTGACTCTAAAGG - Intronic
917901896 1:179551143-179551165 GGGGCATAATGTGACTGTAAAGG - Exonic
918490285 1:185074345-185074367 GGGGTAGGATGGGACTGTAGGGG + Intronic
919767610 1:201137253-201137275 AGGGGAGGCTGAGGCTGGAAGGG - Intronic
920023263 1:202971725-202971747 AGGGGAGGATGTGGCCATAAAGG - Intergenic
921298320 1:213725378-213725400 CGGGGAGGATGTGTGTGTTAAGG - Intergenic
923871564 1:237999930-237999952 AGGGGATGATGTAAATGTGAGGG + Intergenic
924036853 1:239946393-239946415 AGGTGAGGATGTGATCATAATGG + Intergenic
924445638 1:244127846-244127868 TGGCGAGGATGTCACTGAAAAGG + Intergenic
924702059 1:246464010-246464032 AGGCGAGGATGAGCCTGCAAAGG + Intronic
1063075782 10:2714826-2714848 ATGGGAGGATGTCATTGTTATGG - Intergenic
1063431836 10:5997843-5997865 AGTGTAGGAATTGACTGTAAAGG - Intergenic
1063442435 10:6083846-6083868 GGGGGAGGATGTAACTTGAAAGG + Intergenic
1065285129 10:24180223-24180245 AGGGAAGGACCTGACTGTAGAGG - Intronic
1065786640 10:29221913-29221935 ATGAGAGGATGTGACTGTAAAGG - Intergenic
1066194791 10:33088695-33088717 GGGGTAGGATGTGAGTGTCAGGG + Intergenic
1067242253 10:44506813-44506835 AGGGGAGCATGTGAAGGGAAAGG + Intergenic
1068796569 10:61088623-61088645 AGGTGAGGATGAGACTATAAAGG - Intergenic
1069700557 10:70421856-70421878 CGGGGAGGTGGAGACTGTAATGG - Exonic
1070843088 10:79501767-79501789 ACAGGAGGATGTGACTGTGGTGG + Intergenic
1070988952 10:80714720-80714742 CGGGGAGGGTGTGAGTGTAGGGG + Intergenic
1071079368 10:81792178-81792200 AGGGGAGAATGAGACGGAAAAGG - Intergenic
1071760880 10:88605181-88605203 TGGTGAGGCTGTGAGTGTAAAGG + Intronic
1071820870 10:89279468-89279490 AGGGAAAGATGGGAGTGTAAGGG + Intronic
1071984230 10:91034740-91034762 GGGGGAGGTTGTGACTGTGTTGG + Intergenic
1072622102 10:97086981-97087003 AGGGGAGGCTGTGCTTGTGAGGG + Intronic
1073402399 10:103269209-103269231 GTGGGAGGATGTAACTATAAAGG - Intergenic
1073625234 10:105089946-105089968 AAGGATGGATGTGGCTGTAATGG - Intronic
1073855292 10:107666468-107666490 AGAGGAGGAAGTTACAGTAAAGG + Intergenic
1075490204 10:122860184-122860206 AGGGGAGAAGCTGACTGTAGGGG - Intronic
1076083789 10:127607022-127607044 AGAGGAGGATTTGACTGGAAAGG - Intergenic
1076161477 10:128247349-128247371 AGGGGAGGATGAGACCCTGAGGG + Intergenic
1076305707 10:129464571-129464593 AGGCGATGATGAGATTGTAATGG + Intergenic
1077651421 11:3976384-3976406 AGGGGAGGTTTTGACTACAAGGG + Intronic
1078287790 11:9975474-9975496 GTGGGAAGATGTGACTATAAAGG + Intronic
1078365336 11:10701762-10701784 AGGGGAGGGGGTGAGAGTAAAGG - Intergenic
1079285389 11:19125930-19125952 ACGGGAGGGTATGACTGCAAAGG + Intronic
1081057967 11:38434426-38434448 ATGGGAGGAAGTGACTGCAAAGG - Intergenic
1081975487 11:47231872-47231894 AGGGGAGGGTGTGATTACAATGG + Intronic
1084273404 11:68040460-68040482 AGGGGAGGAAGTGACTGGCTGGG + Intronic
1084967278 11:72751380-72751402 AGGGGAGGGGATGACTGGAATGG - Intronic
1084979222 11:72820355-72820377 AGGGGTGAATGTGACTAAAAAGG - Intronic
1085439130 11:76541893-76541915 ATGGGAGGATGCAACTTTAAGGG + Intronic
1085483411 11:76841620-76841642 AGGGAAGGATGAGGCTGGAAGGG - Intergenic
1086198179 11:84167034-84167056 AGAGGAGGCTGTGACAGTTAGGG - Intronic
1088280232 11:108127679-108127701 AGGGGAAGATGAGATAGTAAAGG + Intronic
1090529533 11:127576425-127576447 AGGGTAGCATGTGATTGCAAGGG - Intergenic
1090728896 11:129552667-129552689 AGGGGAGGAAGGGCCTGGAATGG + Intergenic
1093974810 12:25409813-25409835 AGAAGTGGATGTGGCTGTAAAGG - Intronic
1094167726 12:27459755-27459777 ATGTGAGGATGTGAGTGTGATGG - Intergenic
1094368050 12:29705158-29705180 AGGGGAGGATGCTACTGGAGGGG + Intronic
1096290320 12:50336741-50336763 AGTGGGGGATGAGACTGGAATGG + Intronic
1096519519 12:52176385-52176407 AGGGTAGATTGTGACTGTTATGG + Intronic
1096826096 12:54279474-54279496 AGGGGAGTCGGTGCCTGTAATGG - Intronic
1098593407 12:72241292-72241314 AGGGGAGTATGTGACTACAAAGG - Intronic
1098870152 12:75808460-75808482 AAGGGATCATGTGATTGTAATGG + Intergenic
1099301150 12:80896003-80896025 AGGAGAGCAGGTGACTTTAAAGG + Intronic
1099638012 12:85240858-85240880 GGGAAAGGATGTGACTATAAAGG + Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1102240885 12:111323914-111323936 ATGGTAGCATGTGCCTGTAAGGG + Intronic
1102833130 12:116026113-116026135 ATGGTGGGATGTGACTGGAAAGG + Intronic
1103159617 12:118717986-118718008 AGGGGAGGAGGTGTCAGGAAAGG - Intergenic
1104660022 12:130604988-130605010 TGTGCAGGATGTGACTGTACTGG - Intronic
1104986213 12:132598836-132598858 AGGTGAGGAAGCGACTGTGAGGG - Intergenic
1105816526 13:24041113-24041135 GGGGTAGGATGTGGCTGAAATGG + Intronic
1106538169 13:30666245-30666267 AGGGGAGGGAGTGGCTGAAATGG + Intergenic
1108238309 13:48432519-48432541 AGGGTGGAATGTGACTGAAATGG - Intronic
1109614428 13:64811461-64811483 AAGGCAGGATGTGCTTGTAATGG - Intergenic
1110834748 13:80070842-80070864 AGGAGAGACTGTGAGTGTAACGG + Intergenic
1111082288 13:83327277-83327299 TGGAGAGGATGTGACTATCACGG + Intergenic
1111377743 13:87402586-87402608 CTGGGAGGATGAGGCTGTAAGGG + Intergenic
1112833044 13:103477296-103477318 ATGGGAGAAGATGACTGTAATGG + Intergenic
1114642671 14:24233901-24233923 AGGGATGCATGTGACTGTGAGGG - Intronic
1115654043 14:35426064-35426086 AGGGGACAGTGTGACTGTGAGGG - Intergenic
1120099740 14:80430976-80430998 AGGGGAAGATAAGAGTGTAAAGG - Intergenic
1120272519 14:82331674-82331696 AAAGGAGGATGGGAATGTAAAGG - Intergenic
1120707794 14:87762220-87762242 GGGAGAGTATGTGACTGTGAAGG - Intergenic
1122253241 14:100455922-100455944 TGGGGAAGATTTGACTGAAATGG + Intronic
1122863326 14:104592318-104592340 CTGGGAGGATGTGAGTGTGAGGG - Intronic
1123667051 15:22616080-22616102 AAAGGAGGATGTGGCTGTAGGGG - Intergenic
1124320892 15:28710648-28710670 AAAGGAGGATGTGGCTGTAGGGG - Intronic
1124481602 15:30084707-30084729 AAAGGAGGATGTGGCTGTAGGGG + Intronic
1124488059 15:30136802-30136824 AAAGGAGGATGTGGCTGTAGGGG + Intronic
1124563103 15:30793227-30793249 AAAGGAGGATGTGGCTGTAGGGG + Intergenic
1124755468 15:32401517-32401539 AAAGGAGGATGTGGCTGTAGGGG - Intronic
1124960186 15:34387994-34388016 AAAGGAGGATGTGGCTGTAGGGG - Intronic
1124976815 15:34534215-34534237 AAAGGAGGATGTGGCTGTAGGGG - Intronic
1125322305 15:38501305-38501327 AGGCAAGGATGTGAGTATAAGGG + Intronic
1128437616 15:67670316-67670338 GGAGGAGGAGTTGACTGTAAAGG + Intronic
1128565354 15:68697514-68697536 TGGTGAGGAGGTGACTGGAAGGG + Intronic
1129195979 15:73966842-73966864 AGGGGAGGGTGTGGCTGTAAAGG + Intergenic
1129310224 15:74702400-74702422 ATGGGAGGGTATGACTGTAAAGG + Intergenic
1130260074 15:82347671-82347693 AAAGGAGGATGTGGCTGTAGGGG - Intronic
1130268655 15:82431766-82431788 AAAGGAGGATGTGGCTGTAGGGG + Intronic
1130281157 15:82521340-82521362 AAAGGAGGATGTGGCTGTAGGGG + Intergenic
1130472528 15:84237522-84237544 AAAGGAGGATGTGGCTGTAGGGG + Intronic
1130480020 15:84352093-84352115 AAAGGAGGATGTGGCTGTAGGGG + Intergenic
1130491750 15:84436036-84436058 AAAGGAGGATGTGGCTGTAGGGG - Intergenic
1130503365 15:84515076-84515098 AAAGGAGGATGTGGCTGTAGGGG - Intergenic
1130594825 15:85242156-85242178 AAAGGAGGATGTGGCTGTAGGGG + Intergenic
1131248774 15:90817671-90817693 AGGGGAGGATGGGCCCGTGATGG - Intergenic
1132101629 15:99027539-99027561 AAGGGAGGATGAGATTGTTAAGG - Intergenic
1132410713 15:101576414-101576436 AGGGGAGGCTGTGCCTGTAGTGG + Intergenic
1135636747 16:24083679-24083701 AGAAGAGGATGTGACTATAGAGG + Intronic
1137482370 16:48863273-48863295 AGGGGAGGATGTGACTGTAAAGG + Intergenic
1139517039 16:67458272-67458294 AGGAGGGGATGTGACTGGGAGGG + Intronic
1142093076 16:88225523-88225545 CGGGGAGGAGGTGAATGCAAAGG + Intergenic
1143200395 17:5109429-5109451 AGAGGAGGCTGTGACTGTGCTGG - Exonic
1144408608 17:14976839-14976861 AGGGGAGGGGGTGACAGTAGGGG - Intergenic
1145802320 17:27696000-27696022 GGGGGAGGTAGAGACTGTAATGG - Intergenic
1146172711 17:30645939-30645961 AGGGCAGGTTGTGCCTGTCAGGG - Intergenic
1148025624 17:44585652-44585674 AGGGGAGGCTGTGAGTTAAAAGG - Intergenic
1148189149 17:45666750-45666772 ATGGAAGGATGTGACAGTGATGG - Intergenic
1148521129 17:48275993-48276015 GGGGGAGGGTCTGACTGCAATGG + Intronic
1148663149 17:49352964-49352986 AGGGGAGGGTATGAGTGCAATGG + Intronic
1151642780 17:75408208-75408230 AGGTGAGGAGATGATTGTAAGGG + Intergenic
1151691395 17:75688192-75688214 AGGGGAGGAAGAGGCTGAAATGG + Intronic
1152335793 17:79699734-79699756 AGGTGAGAGTGTGACTGTCATGG + Intergenic
1152908343 17:82982723-82982745 AGGAGAAAATGTGACTCTAAAGG + Intronic
1154080520 18:11251645-11251667 AGGGGAGGTGGAAACTGTAATGG + Intergenic
1155717689 18:28967464-28967486 AGTGGAGGATGTTCCTATAAGGG + Intergenic
1156436279 18:37133375-37133397 AGGGGAAGTTGTGACTGCACTGG + Intronic
1157905823 18:51569207-51569229 AGGGCATGATGTGACTCTGAGGG - Intergenic
1158214300 18:55083344-55083366 GGGGGAGGGTGTGACTTCAAAGG + Intergenic
1159948885 18:74464439-74464461 GGGGGAGGATGTGCCTGCCAGGG - Intergenic
1160273939 18:77412613-77412635 GGGGGTGGCTGTGACTGGAAGGG - Intergenic
1160350772 18:78176472-78176494 AGAGGAGGATGTGTCTGAGAGGG + Intergenic
1160972490 19:1775693-1775715 AGGGGAGGGAGTGACAGAAAGGG + Exonic
1161874370 19:6896302-6896324 AAGGGTGGAGGTGACTGTTATGG - Intronic
1162123525 19:8486694-8486716 AGGGAAAGAAGTGGCTGTAACGG + Intronic
1162269757 19:9604652-9604674 GGGGGAGGATGTGTCTGAAAGGG - Intergenic
1162554376 19:11377713-11377735 AGGGGAAGATGGGACTTAAAGGG + Exonic
1165208789 19:34215754-34215776 GGCGGGGGTTGTGACTGTAAAGG + Intronic
1165918884 19:39279685-39279707 GAGGGAGGATGTGACTGTAAAGG - Intergenic
1166411983 19:42561607-42561629 TGGGGAGGATGGGACTCTGAGGG - Intergenic
1167903234 19:52637795-52637817 AGGGGAAGAGGTGACTGTGGAGG + Intronic
1168337872 19:55606393-55606415 GGGAGAGGATGTGAGTGTGAAGG - Intronic
925254192 2:2468252-2468274 AGGGGAGGATGTGCCTGTTAGGG - Intergenic
925275397 2:2644941-2644963 AGGGGAGGTGGTGGCTGGAACGG - Intergenic
925275412 2:2644986-2645008 AGGGGAGGTTGTGGCTGGAACGG - Intergenic
925275426 2:2645031-2645053 AGGGGAGGTTGTGGCTGGAATGG - Intergenic
926220505 2:10932805-10932827 AGGGGAGGATGTATCTGTCTGGG + Intergenic
926730926 2:16034763-16034785 AGGGGTGGAGCTGACTGCAAAGG + Intergenic
927992732 2:27459684-27459706 ATGGGAGTATGGGAATGTAAAGG - Intronic
928853456 2:35776721-35776743 AGGTAAGAATGTTACTGTAAAGG + Intergenic
929458678 2:42085347-42085369 AGGGCAGGAAGAGACTGCAAGGG - Intergenic
930234083 2:48872515-48872537 TGGGGATGGTGTGACTGAAATGG - Intergenic
930610496 2:53537750-53537772 AGGGAAATATGTCACTGTAATGG + Intronic
930799907 2:55433263-55433285 AGGGGAGGAGGTAACTGTGGTGG - Intergenic
931984653 2:67729964-67729986 ATGGGAGTGTTTGACTGTAACGG - Intergenic
932702031 2:73998696-73998718 AGGGGATGATGTGTGTGTGATGG + Intronic
933587331 2:84193684-84193706 AGGGGTGGATGCGACTAGAAAGG + Intergenic
934691279 2:96361634-96361656 AGCAGAGGATGTGAATGGAATGG - Intronic
935006500 2:99083816-99083838 AAGAGGAGATGTGACTGTAAAGG + Intronic
936291901 2:111232299-111232321 AGCAGTGGATGTGACTTTAAAGG + Intergenic
936622865 2:114118425-114118447 AGGGGAGGATGTGGATGTCCTGG + Intergenic
938784289 2:134610830-134610852 AGGGGAGAATGTGAGTGTGGGGG + Intronic
942657446 2:178229080-178229102 ATGGGAGCATGTGTGTGTAAAGG + Intronic
943194405 2:184725779-184725801 AGAGGAGGGTGTGACTATAAAGG - Intronic
944481609 2:200163156-200163178 GGGGCAGGCTGTGACTGTAAAGG + Intergenic
945466775 2:210178779-210178801 TGGAGAGGGTGTGACTATAAAGG + Intergenic
946128213 2:217583041-217583063 AAGGGAGGATGTGATAGTGAAGG + Intronic
947028587 2:225766716-225766738 AAAGGAGCATGTCACTGTAACGG - Intergenic
948844068 2:240674847-240674869 AGAGGAGGATGTGTGTGTGAAGG + Intergenic
1168866424 20:1090767-1090789 AGGGAAGGATGTGCCTGCATAGG + Intergenic
1168947277 20:1771809-1771831 AGGTGGGGATGTGCCTGTAGTGG - Intergenic
1170335968 20:15270460-15270482 AGGGGAGGATGTGACTGTAAAGG + Intronic
1170428722 20:16259005-16259027 AGGGGTGGATGTGTCTGGGATGG - Intergenic
1170467226 20:16633233-16633255 AGGGGAAGAATTGACTGTAATGG - Intergenic
1172215495 20:33232878-33232900 AAGGCAGGGTGTGGCTGTAAAGG + Intergenic
1172375846 20:34439561-34439583 AGGGGAAGATGTGGCTGCAGTGG - Intronic
1172501610 20:35432045-35432067 AGGGGAGAATGGGCCTGGAAGGG - Intergenic
1172741423 20:37170936-37170958 GGGAGAGGATGTGACTAAAAAGG - Intronic
1173829496 20:46072069-46072091 AAGGGAGGATGAGGCTTTAAGGG - Intronic
1174292509 20:49519160-49519182 AGGGGAAGAGGAGGCTGTAAGGG - Intronic
1175781293 20:61683964-61683986 AGGGGATGATGTGGTTGTGATGG - Intronic
1176019940 20:62957399-62957421 AGGTGAGGATGTGGCTGTGCAGG - Intronic
1178519695 21:33278286-33278308 CAGGGAGGATGTAACTGTAGGGG - Intronic
1179773196 21:43640410-43640432 TGGGGTGGATGTGGCTATAAAGG + Intronic
1181301891 22:21886214-21886236 AGGGGAGAATATGACTATAAAGG - Intergenic
1181901313 22:26158563-26158585 GGGGGACTATGTGACTGTAAAGG - Intergenic
1182618113 22:31602345-31602367 AGGGGAGGCCGTGAGTGCAATGG - Intronic
1182925889 22:34124436-34124458 AGGGAAGGGTGGGACTGTGAAGG - Intergenic
1183780556 22:39996040-39996062 AGGAGAGGCTGTGACTGTGAGGG - Intronic
1183974019 22:41499875-41499897 ATGGGAGGCTGTGACTGTCAAGG + Intronic
1184089270 22:42283826-42283848 AGGGAAGGATGCGGCTGCAAAGG - Intronic
949862084 3:8515239-8515261 AGTGGAAGATGTGGCTGAAAAGG - Intronic
952324369 3:32307652-32307674 ATGGGAGGAGGTGACTGCTAGGG + Intronic
952424851 3:33165353-33165375 AAGGGAGGCTGGGACTGAAAGGG + Intronic
952645752 3:35656661-35656683 AGGGAGGGGTGTCACTGTAAAGG + Intronic
952727160 3:36598127-36598149 TGGGGAAGTTGTGACTGTTATGG - Intergenic
953732787 3:45464519-45464541 AGGGGACGATGTGACTGGAGAGG - Intronic
954402255 3:50325186-50325208 AGGGGTGGGGGTTACTGTAAGGG + Exonic
954438853 3:50510707-50510729 AGGGGAGGATGGCACTGTATGGG + Intergenic
955366577 3:58315388-58315410 AGGGGTGGGTGTGGCTGTAAAGG + Intronic
955416646 3:58698377-58698399 TGGGGAGGCTGTGACTATAAAGG + Intergenic
955801492 3:62691402-62691424 AGGGGAGGCTGTGTCTGTGTAGG + Intronic
955990096 3:64617384-64617406 TGGGGATGATGTTACTGTCAGGG - Intronic
956558411 3:70546515-70546537 AAGGGCTGATGTGAATGTAAAGG - Intergenic
960516586 3:118608561-118608583 AGGGGTGAAAGGGACTGTAAGGG - Intergenic
961809278 3:129512689-129512711 AGATGAGGGTGTGACTGAAATGG + Intronic
962730423 3:138278105-138278127 GGGGCAGGATTTGACTATAAAGG + Intronic
963211496 3:142697417-142697439 AGGGGAGTATGAGAGAGTAAGGG - Intronic
964076504 3:152699434-152699456 AGTGGAGGAAGTAACTGCAAAGG - Intergenic
964670906 3:159225389-159225411 AGGGGTGGTTATGGCTGTAAGGG + Intronic
965389793 3:168091396-168091418 AGGAGAGGGTGTGACTGCTAAGG - Intronic
966797108 3:183725856-183725878 ATGGGAGGATGTAAGTGTGATGG + Intronic
966815129 3:183884478-183884500 TGGGAAGGACGTGACTGGAAGGG - Intronic
967151653 3:186656370-186656392 AGGGGAGGCTGTGAGCGTGAGGG + Intergenic
967713355 3:192735158-192735180 AGGTGACCATGGGACTGTAAAGG + Intronic
969072941 4:4553965-4553987 AGGGGAAAATGTGATTTTAAGGG + Intergenic
969975138 4:11091746-11091768 AGGGGAGGTTGTGTGTATAATGG + Intergenic
972572624 4:40324688-40324710 AGGTGAGGATGTGAAGGGAAAGG + Intergenic
972836718 4:42879857-42879879 AGTGTAGGTTGTGACTTTAATGG + Intergenic
973017884 4:45164581-45164603 ATGGGAGGATCTGAATGAAAAGG - Intergenic
973635163 4:52855415-52855437 AGGGGAGGATGGGCCTCAAAGGG - Intergenic
973862357 4:55077897-55077919 GGGGGTGGGTGTGACTGTGAGGG + Intergenic
974324708 4:60398631-60398653 AGGGGGTGGTGTGACTGTACTGG + Intergenic
974550052 4:63360287-63360309 AGGGGAGGTTCAGACTTTAAAGG + Intergenic
974588309 4:63910544-63910566 AGTGGATGAGGTTACTGTAATGG - Intergenic
975175836 4:71288146-71288168 AGGGGAGGCTGTGTCAGAAAGGG + Intronic
975342506 4:73258229-73258251 GAGGGAGGAAGGGACTGTAAGGG - Intronic
977149794 4:93496515-93496537 AAGGGTGAATGTGACTATAAAGG - Intronic
978802992 4:112772866-112772888 AGGGTAGGAGGTGACGGTACTGG + Intergenic
980156858 4:129117956-129117978 AGGGGAGGATGTGAGGGTGCAGG - Intergenic
981075151 4:140583571-140583593 AGGGAAGGATTTGACTACAAAGG + Intergenic
981960455 4:150531328-150531350 AGGGAGGAATGTGACTGGAATGG - Intronic
982155401 4:152515334-152515356 AGGGAAGGATTTAACTGTGAAGG + Intronic
984088048 4:175336180-175336202 AGGGGATCATATCACTGTAATGG + Intergenic
986361481 5:6982223-6982245 AGGGGAGGAAGTGGCTATAGTGG - Intergenic
986448045 5:7840257-7840279 AGGGGTGGAGGTCACTGTGAGGG - Intronic
986779800 5:11054860-11054882 AGGAGAGGATGGAAATGTAAAGG - Intronic
989145088 5:38241637-38241659 AGGGGAGGAGCTGACTACAAGGG - Intergenic
989645019 5:43621736-43621758 ACCGGATGATGTGACAGTAATGG + Intronic
991369748 5:65905734-65905756 GGGGGAGGTAGTGACTGGAAGGG + Intergenic
991608461 5:68426733-68426755 AAGGGATGATGAGACTGAAATGG - Intergenic
992153077 5:73925611-73925633 AGGGGAGGGGTTGACTGGAAAGG - Intronic
993489524 5:88529648-88529670 AGGGGTGGGTGTGACTCTCAAGG - Intergenic
994260100 5:97647949-97647971 AGGGGAGGCTGTGCATGTATGGG - Intergenic
994926297 5:106121062-106121084 GGGTGAGGATGTGGCTGAAATGG + Intergenic
995384300 5:111571840-111571862 ATGGGAGGCTTTGACTGTATTGG - Intergenic
997855232 5:137367307-137367329 AGGGGTGGGTGTGACTGTTCAGG - Intronic
998696247 5:144643094-144643116 AGGGGTGGATGTGTCTATAAAGG + Intergenic
1001594216 5:172887418-172887440 AGGGAAAGAAGTGTCTGTAAAGG - Intronic
1002590363 5:180287137-180287159 AGGGGCTGCTGTGGCTGTAAGGG + Intronic
1004145253 6:13060018-13060040 AGAGGAGGAGGAGCCTGTAAAGG + Intronic
1004588051 6:17021939-17021961 AGGGGAGGCTGTGCATGTAGGGG - Intergenic
1004796369 6:19090403-19090425 ATGGAAGGATGTGACAGGAAAGG + Intergenic
1005373234 6:25156294-25156316 CAGTGGGGATGTGACTGTAAAGG - Intergenic
1006418764 6:33920566-33920588 AGAGGGGGATGTGTCTGTGATGG - Intergenic
1006421565 6:33937434-33937456 TGGGGAGGCTGTGAATGTAGGGG - Intergenic
1007257725 6:40540509-40540531 AGGGGAGGAGGAGACAGTCAGGG + Intronic
1007848377 6:44780086-44780108 AGGGGAGGAAGAGACTGTGGAGG + Intergenic
1008077701 6:47163003-47163025 AGGTGACGATGTGACTGAATGGG - Intergenic
1008715371 6:54282915-54282937 AGAGGAGGCTGTGATTGGAATGG + Intergenic
1012382886 6:98641214-98641236 TGGGGAGGAGATGGCTGTAAAGG - Intergenic
1013795890 6:113888479-113888501 AGGGGAGGAGGTGAGTGATAAGG + Intergenic
1015924231 6:138293310-138293332 AGGGGAGGATTTGAAGGTCACGG - Intronic
1016818657 6:148326898-148326920 AGGGCAGGATGTGACGGTGGAGG - Intronic
1017410730 6:154165285-154165307 AGGAGAGGATGGGACTGAGAGGG - Intronic
1021398184 7:20176924-20176946 AGGAGTGGATGTAACTATAAAGG + Intronic
1021725637 7:23545562-23545584 AGGTGAGGAAGTGACTGTGGTGG - Intergenic
1023575403 7:41621310-41621332 AGGGGATGATGTGACCCTAGTGG + Intergenic
1023794600 7:43781286-43781308 AGGGGAGGTTGTGACTATAAAGG - Intronic
1023875763 7:44285446-44285468 AGGGGAGGCTGTTCCTGTAGGGG - Intronic
1025961741 7:66229027-66229049 AGGGGACTGTGTGACTATAAAGG - Intronic
1025986546 7:66457930-66457952 AGGAAAGAATGTGACTATAAAGG + Intergenic
1026028461 7:66767456-66767478 AGGAAAGAATGTGACTATAAAGG - Intronic
1027209813 7:76136783-76136805 AGGAAAGGATGTGACTATAAAGG + Intergenic
1028586186 7:92454104-92454126 AGGGGAGGATGTGCATGTGTGGG + Intronic
1029273511 7:99391119-99391141 AGGGGAGGAGGTGAGTGCAGAGG + Intronic
1030527834 7:110674747-110674769 TTGGAAGGATGTGACTGTGAAGG - Intronic
1031771848 7:125853778-125853800 AGGAGAGGATGTGCCTGTACAGG - Intergenic
1032155103 7:129461464-129461486 AGGGGGGGATGTGTCAGGAAAGG + Intronic
1032489718 7:132315117-132315139 AGGGGAGGATGTGTGAGCAAGGG + Intronic
1037935225 8:22911019-22911041 AGGGGAGGCTGTGCCTGTGTGGG + Intronic
1038027519 8:23605453-23605475 AGGGGAGGTTATGACAGCAATGG + Intergenic
1038419603 8:27424079-27424101 AGGGGAAGATGAGACAGTACAGG - Intronic
1039878074 8:41604462-41604484 AGAGCAGCATGTGACTGGAAGGG + Intronic
1040052183 8:43026775-43026797 TGGGGAAGAGGTGACTGGAAAGG + Exonic
1040979639 8:53233308-53233330 AGGGGAGGATGTGCCTGTGTGGG + Intronic
1041141362 8:54823184-54823206 TGGGGGAGCTGTGACTGTAAAGG - Intergenic
1041679748 8:60576796-60576818 GAGGGAGGAAGTGACAGTAATGG - Intronic
1042879857 8:73475110-73475132 GGGAGAGGGTGTGACTGGAAGGG + Intronic
1044378882 8:91508967-91508989 AGGGGAGGATGGAACTATATGGG - Intergenic
1045012818 8:97973273-97973295 GGGGGAGGATGTGATTGGCAAGG - Intronic
1045037618 8:98188192-98188214 AGGAGAGGCTGTGCCTGTGAAGG + Intergenic
1046054741 8:109065892-109065914 AGAGGAGGATGTGCATGTGACGG - Intergenic
1047325760 8:123834488-123834510 AGAGGAGGATGTGGCTGGAGAGG + Intergenic
1047635758 8:126760315-126760337 AAGGAAGGCTGTGACTGGAAGGG - Intergenic
1048035625 8:130674667-130674689 AGGGGAGGAAGTGATGGGAAAGG - Intergenic
1048536855 8:135304574-135304596 ATGCGAAGATGTGACTGGAAAGG + Intergenic
1049788365 8:144462135-144462157 GGGCGAGGAAGTGGCTGTAAGGG + Intronic
1049880312 8:145057497-145057519 AAGGGAGCCTGTGACTTTAATGG - Intergenic
1050083619 9:1941079-1941101 AGTGGAGGATGAGGCTGGAAAGG - Intergenic
1052139301 9:24958901-24958923 GGGGGAGGAAGTGAATGAAAGGG - Intergenic
1052832067 9:33223724-33223746 AGGGGAGGATGTTTTTTTAAAGG + Intronic
1054933183 9:70657891-70657913 AGGTGAGTGTGTGATTGTAAGGG + Intronic
1055053608 9:72003520-72003542 AGGGGTGGGTGTGACTGTAAAGG + Intergenic
1055236607 9:74130017-74130039 GGGGGAGGGTGTGACTGGAAAGG + Intergenic
1055350933 9:75387371-75387393 AGGGGATGATGTCAGTTTAAGGG + Intergenic
1055434925 9:76282941-76282963 AGTGGAGGAAGTGACTGCAGAGG + Intronic
1056066763 9:82943674-82943696 AGGGGAGTGTGTGACTACAAAGG - Intergenic
1056235099 9:84586532-84586554 GGGAGTGGATGTGACTGGAAAGG - Intergenic
1056807777 9:89742114-89742136 GGGGGAGGTTGTGAATATAAAGG + Intergenic
1057792973 9:98136082-98136104 AGGGCAGGACGTGACTGTTGGGG - Intronic
1060937720 9:127525301-127525323 AGGGGAGAATGTCACTATCATGG + Intronic
1061816049 9:133197220-133197242 GGGGGAGGATTTGACTGTGGAGG + Intergenic
1186853788 X:13606492-13606514 AGTGGACGATATGACTGTATAGG + Exonic
1187428267 X:19198182-19198204 AGGAGAGGAACTGACTGGAAAGG - Intergenic
1189230682 X:39450432-39450454 TGGGGAGGAAGGGACTGTCATGG - Intergenic
1190340830 X:49294211-49294233 AGGAGAGGGAGTGACTCTAAGGG - Intronic
1190580482 X:51888980-51889002 AGGGTTGGTTGTGACTATAATGG + Intronic
1190729698 X:53217479-53217501 GGTGGAGGAAGTGACTGGAAGGG - Intronic
1193535293 X:82707868-82707890 AAGGCAGGATGTGAGTTTAATGG - Intergenic
1193594419 X:83428843-83428865 AGGGGAGGATGTGAAGAAAATGG + Intergenic
1194346428 X:92771804-92771826 AGGGGTGGAGGTTACTGTAGGGG - Intergenic
1195511903 X:105725464-105725486 AGGAGAGGATGTTAAGGTAAAGG - Intronic
1196413474 X:115445241-115445263 AGGAGTGGATGTGACTATGAAGG + Intergenic
1197146860 X:123181535-123181557 AGGGGAGGATGACAATGGAAGGG + Intergenic
1197392117 X:125880317-125880339 AGGGGAAGCTGTGAATGTATGGG - Intergenic
1198143541 X:133831106-133831128 AGGGAAGAGTGTGACTGTTAAGG + Intronic
1199315598 X:146374096-146374118 TGGGGAAGATGTAACTGAAAGGG - Intergenic
1200654765 Y:5888453-5888475 AGGGGTGGAGGTTACTGTAGGGG - Intergenic
1202366565 Y:24169849-24169871 AAAGGAGGATGTGGCTGTAGGGG + Intergenic
1202504217 Y:25500274-25500296 AAAGGAGGATGTGGCTGTAGGGG - Intergenic