ID: 1137483408

View in Genome Browser
Species Human (GRCh38)
Location 16:48871332-48871354
Sequence CTGGAGAAGAGGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137483400_1137483408 9 Left 1137483400 16:48871300-48871322 CCACGCCCTCCATCTGGACTGGT No data
Right 1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG No data
1137483397_1137483408 17 Left 1137483397 16:48871292-48871314 CCAGTACTCCACGCCCTCCATCT No data
Right 1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG No data
1137483401_1137483408 4 Left 1137483401 16:48871305-48871327 CCCTCCATCTGGACTGGTGAGTT No data
Right 1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG No data
1137483403_1137483408 0 Left 1137483403 16:48871309-48871331 CCATCTGGACTGGTGAGTTTAGG No data
Right 1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG No data
1137483402_1137483408 3 Left 1137483402 16:48871306-48871328 CCTCCATCTGGACTGGTGAGTTT No data
Right 1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137483408 Original CRISPR CTGGAGAAGAGGAAAGAGGA AGG Intergenic
No off target data available for this crispr