ID: 1137483828

View in Genome Browser
Species Human (GRCh38)
Location 16:48875104-48875126
Sequence GGTGGGAGAGACTCCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137483828_1137483830 -7 Left 1137483828 16:48875104-48875126 CCTGCATTGGAGTCTCTCCCACC No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483828_1137483836 12 Left 1137483828 16:48875104-48875126 CCTGCATTGGAGTCTCTCCCACC No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483828_1137483837 16 Left 1137483828 16:48875104-48875126 CCTGCATTGGAGTCTCTCCCACC No data
Right 1137483837 16:48875143-48875165 TCTCACCCCAGTGAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137483828 Original CRISPR GGTGGGAGAGACTCCAATGC AGG (reversed) Intergenic
No off target data available for this crispr