ID: 1137483830

View in Genome Browser
Species Human (GRCh38)
Location 16:48875120-48875142
Sequence TCCCACCAGGCCTCTAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137483821_1137483830 29 Left 1137483821 16:48875068-48875090 CCTGGTCCAGGACGCCTCATCCT No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483823_1137483830 15 Left 1137483823 16:48875082-48875104 CCTCATCCTCTCCCATCTTCTTC No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483824_1137483830 9 Left 1137483824 16:48875088-48875110 CCTCTCCCATCTTCTTCCTGCAT No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483828_1137483830 -7 Left 1137483828 16:48875104-48875126 CCTGCATTGGAGTCTCTCCCACC No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483826_1137483830 4 Left 1137483826 16:48875093-48875115 CCCATCTTCTTCCTGCATTGGAG No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483827_1137483830 3 Left 1137483827 16:48875094-48875116 CCATCTTCTTCCTGCATTGGAGT No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data
1137483822_1137483830 23 Left 1137483822 16:48875074-48875096 CCAGGACGCCTCATCCTCTCCCA No data
Right 1137483830 16:48875120-48875142 TCCCACCAGGCCTCTAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137483830 Original CRISPR TCCCACCAGGCCTCTAGCCA TGG Intergenic