ID: 1137483836

View in Genome Browser
Species Human (GRCh38)
Location 16:48875139-48875161
Sequence ATGGTCTCACCCCAGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137483831_1137483836 -5 Left 1137483831 16:48875121-48875143 CCCACCAGGCCTCTAGCCATGGT No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483826_1137483836 23 Left 1137483826 16:48875093-48875115 CCCATCTTCTTCCTGCATTGGAG No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483827_1137483836 22 Left 1137483827 16:48875094-48875116 CCATCTTCTTCCTGCATTGGAGT No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483832_1137483836 -6 Left 1137483832 16:48875122-48875144 CCACCAGGCCTCTAGCCATGGTC No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483833_1137483836 -9 Left 1137483833 16:48875125-48875147 CCAGGCCTCTAGCCATGGTCTCA No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483828_1137483836 12 Left 1137483828 16:48875104-48875126 CCTGCATTGGAGTCTCTCCCACC No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data
1137483824_1137483836 28 Left 1137483824 16:48875088-48875110 CCTCTCCCATCTTCTTCCTGCAT No data
Right 1137483836 16:48875139-48875161 ATGGTCTCACCCCAGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137483836 Original CRISPR ATGGTCTCACCCCAGTGAGC AGG Intergenic