ID: 1137484516

View in Genome Browser
Species Human (GRCh38)
Location 16:48880593-48880615
Sequence CGGTTCTTCTCACAGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137484516_1137484522 1 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484522 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data
1137484516_1137484524 6 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484524 16:48880622-48880644 TAGGGCATGACCTTCAGGCTTGG No data
1137484516_1137484526 24 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137484516 Original CRISPR CGGTTCTTCTCACAGGTCCA AGG (reversed) Intergenic