ID: 1137484522

View in Genome Browser
Species Human (GRCh38)
Location 16:48880617-48880639
Sequence CCCAATAGGGCATGACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137484514_1137484522 27 Left 1137484514 16:48880567-48880589 CCAGGGTCATCTATGGATCTAAG No data
Right 1137484522 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data
1137484513_1137484522 28 Left 1137484513 16:48880566-48880588 CCCAGGGTCATCTATGGATCTAA No data
Right 1137484522 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data
1137484516_1137484522 1 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484522 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data
1137484517_1137484522 -6 Left 1137484517 16:48880600-48880622 CCTGTGAGAAGAACCGACCCAAT No data
Right 1137484522 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137484522 Original CRISPR CCCAATAGGGCATGACCTTC AGG Intergenic