ID: 1137484524

View in Genome Browser
Species Human (GRCh38)
Location 16:48880622-48880644
Sequence TAGGGCATGACCTTCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137484517_1137484524 -1 Left 1137484517 16:48880600-48880622 CCTGTGAGAAGAACCGACCCAAT No data
Right 1137484524 16:48880622-48880644 TAGGGCATGACCTTCAGGCTTGG No data
1137484516_1137484524 6 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484524 16:48880622-48880644 TAGGGCATGACCTTCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137484524 Original CRISPR TAGGGCATGACCTTCAGGCT TGG Intergenic