ID: 1137484524 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:48880622-48880644 |
Sequence | TAGGGCATGACCTTCAGGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137484517_1137484524 | -1 | Left | 1137484517 | 16:48880600-48880622 | CCTGTGAGAAGAACCGACCCAAT | No data | ||
Right | 1137484524 | 16:48880622-48880644 | TAGGGCATGACCTTCAGGCTTGG | No data | ||||
1137484516_1137484524 | 6 | Left | 1137484516 | 16:48880593-48880615 | CCTTGGACCTGTGAGAAGAACCG | No data | ||
Right | 1137484524 | 16:48880622-48880644 | TAGGGCATGACCTTCAGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137484524 | Original CRISPR | TAGGGCATGACCTTCAGGCT TGG | Intergenic | ||