ID: 1137484526

View in Genome Browser
Species Human (GRCh38)
Location 16:48880640-48880662
Sequence CTTGGTCCCTTTTCACCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137484517_1137484526 17 Left 1137484517 16:48880600-48880622 CCTGTGAGAAGAACCGACCCAAT No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data
1137484523_1137484526 -1 Left 1137484523 16:48880618-48880640 CCAATAGGGCATGACCTTCAGGC No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data
1137484516_1137484526 24 Left 1137484516 16:48880593-48880615 CCTTGGACCTGTGAGAAGAACCG No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data
1137484521_1137484526 0 Left 1137484521 16:48880617-48880639 CCCAATAGGGCATGACCTTCAGG No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data
1137484520_1137484526 4 Left 1137484520 16:48880613-48880635 CCGACCCAATAGGGCATGACCTT No data
Right 1137484526 16:48880640-48880662 CTTGGTCCCTTTTCACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137484526 Original CRISPR CTTGGTCCCTTTTCACCTTG TGG Intergenic